Transcript asmbl_33285

Sequence
Transcript Sequence for observation asmbl_33285 of TGE0004776:
GTGAACTAATTCGTTCAAGCCTTGGGCTGCAGAACTGCCCAGAAGAGTGCCGAGAAGGTGGCGCGTAACTTCGGCAGATCCCAGAAGTGCAGCTAGGAAACTTGCCCAGCCAGCCAGGCCCATAGGGTGCTAGAGGGTCAGGAAGGACCCGCCTTTCCTAGACCGTGGCCCAACAGATCCACGTGAGGCTTCCTCGCCACCAAAAGCCCCAAACAAGCAGGGCTAATGAAAGAGGAAAGTTAAGGACGTCCCAAGCTCTGAGACGCGGCGCCCCGCTGCCGGCGCAAGAGCTGCTCTTCCAACAGCTGCGCTTGCAGTCGCCTTGTCCAGCCGAGCGGAGGTCGCTGCCGCTGAGTGATGTCCCGCCGCAGCCTGGACGGGCGCCTCCTCGGGCTGCCCGCGACGTCGGCCCCGCCGCTGCCCCCCAAGTTGCTGCTGTTGCTGCTGCTGTCGGCCGCCGCGGTGCCACCGAGCCTGGCAGAAGTCTTCTATGCAACTGCGTACTGGATGCCTGCTGAAAAGACAGTAAATGTCAAAAATTTACTGGACAAGAATGGGGATGCCTATGGCTTTTATAATAACTCTATGAACACCACAGGCTGGGGGATCCTTGAGATCAAAGCAGGGTATGGTTCTCAGACCCTGAGCAATGACATCATCATGTTTGTGGCTGGATATTTGGAAGGTTACCTCACTGCCCCACACATGTATGACCACTTCATAAATCTCTACCCACAGCTGATTAAGAAACCTTCCATCGTGGATAAAGTGCAGGAGTTTATGAAGAAGCAAGAAGAATGGGCACGTAATAACATCAAATATTATAAGGATGACCCATTTTGGAGACATACTGGCTATGTTATGGCACAAATGGATGGGCTGTATGTAGGAGCGATGAACAGGGCTACATTAATAGGGACAAAGCCTATGACACTGTTCCAGATTCAGTTCCTGAATGCTGTTGGAGATCTGTTGGATCTGATTCCCTCACTTTCTCCCCCAAAAAACTCCAGCCTGAAGGTTTTTAAGAGATGGGACATGGGACACTGCTCTGCTCTTATTAAGGTTCTTCCTGGGTTTGAGAACATCTATTTTGCTCACTCAAGCTGGTACACGTATGCAGCCATGCTCAGGATATATAAACACTGGGACTTCAACATCGTCGATAAAGATACCAGCTGTAGTCGCCTCTCTTTCAGCAGTTACCCAGGATTCTTAGAGTCTCTGGATGACTTTTACATTCTTAGCAGTGGTTTGATATTGCTGCAGACCACAAACAGCGTGTATAATAAAACCCTACTAAAGTTTGTGACACCCCAGTCTCTCCTGGCCTGGCAAAGGGTCCGCGTGGCCAATATGATGGCCAATGGTGGCAGGCAGTGGGCAGAGATCTTTTCAAAATACAATTCTGGCACCTATAACAATCAGTACATGGTCCTGGACCTGAAGAGGGTAAAGCCAAAATATAGCCTTGACACAGAGACTCTGTACATTGTGGAGCAAATTCCTTCATATATAGAATTTTCTGACCAAACCGATGTCCTACGGAAAGGATACTGGCCCTCTTACAACATTCCTTTCCATGAAAAAATCTACAACTGGAGTGGCTATCCAATGTTAGTTCAGAGGCTGGGTTTGGACTACTCATATGATCTGGCTCCACGAGCCAAAATCTTCCGGCGTGACCAAGGGAAAGTGACTGATATGGCATCCATGAAATATATCATGCGATACAACAATTATAAGAACGATCCTTACAGTAGGGGTGATCCGTGCAATACCATCTGCTGCCGTGAGGACCTTAACTCACTTAACCCAAGTCCTGGAGGTTGCTATGATACAAAGGTGGCAGATATTTACCTAGCATCACAGTACACAGCACATGCCATTAGTGGTCCCACAGTACAAGGTGCCCTCCCTGTTTTTCACTGGAACCAGTTCAACAAAACTCTCCATGAGGGCATGCCAGAAGCCTACAACTTTGATTTTGTGACCATGCAACCAATTTTGAAACCTGACAAAAAATGAAGGGGGAATATGAGGGAATAGAAGGCTGCAAATAAGATACCAAAGGCACTATTTTAACTGTTTTTCCATTCAAGATTAGTCTTAATAAAATGTCTTAAATTTAGTCTGTTA