Transcript asmbl_16550

Sequence
Transcript Sequence for observation asmbl_16550 of TGE0003888:
TTTCGGCCCCTGAACCAGGCCGAGATTCTGCGGGGGGACAAATTCATCCCCATTTTTCAAGGGGACGACAGCGTCGTTATTGGGGGAAAGCCATATGTCTTTGACCGTGTATTTCCCCCAAACACGACTCAGGAGCAAGTTTATCATGCATGTGCCATGCAGATTGTCAAAGATGTCCTTGCTGGCTACAATGGCACCATATTTGCTTATGGACAGACATCCTCAGGAAAAACACATACTATGGAGGGAAAGCTGCATGACCCTCAGCTGATGGGAATTATTCCTCGAATTGCCCGAGACATCTTCAACCACATCTACTCCATGGATGAGAATCTTGAGTTCCACATCAAGGTTTCTTACTTTGAGATTTACCTGGACAAAATTCGTGACCTTCTGGATGTGACCAAGACAAATCTGTCTGTGCATGAGGACAAGAACCGGGTGCCATTTGTCAAGGGTTGTACTGAACGCTTTGTGTCCAGCCCAGAGGAGATTTTAGATGTGATTGACGAGGGGAAATCAAACCGTCATGTGGCTGTCACCAACATGAATGAGCACAGCTCTCGCAGCCACAGCATCTTCCTCATCAACATCAAGCAGGAGAACATGGAGACTGAGCAGAAGCTCAGTGGGAAGCTGTATCTGGTGGACCTGGCTGGGAGCGAGAAGGTCAGCAAGACTGGAGCAGAG