Transcript asmbl_32947

Sequence
Transcript Sequence for observation asmbl_32947 of TGE0027253:
GGCAGGGTGCAGCAACTGGAGGCAGCGGCGCGCCTTGAGGCTACAGCAGCGGAGGACAGGAGCTCAGATCCAGAACTGAGCTCTTGACACCATGAACCCTGCCATCGGTATCGCTCTCCTGCTAACAGTCTTGCAGGTAGCCAGTGGGCAGAAGGTGACCAGCCTGACGGCCTGCCTCGTGGACCAGAGCCTTCGTCTGGACTGCCGCCATGAGAATACCACCACTATACCTATCCAGTACGAGTTCAGCCTGACCCGTGATTCAAAGAAGCACGTGCTTTTTGGCACCGTGGGGGTGCCTGAACACACATACCGCTCCCGGACCAACTTCACCAGCAAGTACAACATCAAGGTCCTCTACTTATCCAGCTTCACCACCAAGGACGAGGGAGTATACACATGCGAACTTCGCCTCTCTAGCCAGCACCCTACCTCCTACAACAAGACTGTTTCTGTGTTCAGAGATAAACTGGTCAAGTGTGGAGGCATAAGCCTGCTGACCCAGAACACCTCGTGGTTGCTGCTGCCCCTGCTCTCCCTGCCCC