Transcript asmbl_32160

Sequence
Transcript Sequence for observation asmbl_32160 of TGE0008917:
GCACGAGCCACACCGTCTTCGGGCCGATCCGTGGTGGACGTTTTCGGAGTAGGCGAGCCGCAGCCTGTGCGCCCCCTCACCGTCTCCTGTGAAACCCTGAGCCGGCTGTGTAGCTTTCTCCCTTTGTCTCAACCATGTCCACCAACGAGAATGCTAATTCACCAGCTGCCCGCCTCAACAGATTCAAGAACAAGGGGAAAGACAGTACAGAAATGAGGCGGCGCCGAATAGAAGTTAATGTGGAACTGAGGAAAGCTAAGAAGGATGACCAGATGCTGAAAAGGAGAAATGTAAGCTCGTTTCCTGATGATGCTACTTCTCCACTGCAGGAAAACCGCAACAACCAGGGCACTGTAAATTGGTCTGTTGATGACATTGTCAAAGGCATAAACAGCAACAATTTGGAAAACCAACTCCAAGCTACTCAAGCTGCTAGGAAACTGCTTTCTAGGGAAAAACAGCCACCCATAGACAACATAATCCGGGCTGGTTTGATTCCAAAATTTGTGTCCTTCTTGGGCAGAACTGATTGTAGTCCCATTCAGTTTGAATCTGCTTGGGCCCTCACTAACATTGCTTCTGGAACATCAGAACAGACCAAGGCTGTAGTTGACGGAGGTGCTATCCCAGCATTCATTTCTCTTTTGGCATCGCCCCATGCTCACATCAGTGAACAAGCCGTATGGGCTCTAGGAAACATTGCAGGTGATGGTTCAGTTTTCCGAGACTTGGTTATCAAGTATGGTGCAGTGGACCCACTGTTGGCTCTTCTTGCAGTTCCTGATATGTCATCTTTAGCATGTGGTTACTTACGTAATCTTACCTGGACGCTTTCAAACCTTTGTCGCAATAAGAATCCTGCACCCCCCTTAGATGCTGTTGAGCAAATTCTTCCTACTTTAGTTCGCCTCTTGCATCACGATGATCCAGAGGTATTAGCAGATAGCTGCTGGGCCATTTCCTACCTTACTGATGGTCCAAATGAACGGATTGAAATGGTCGTGAAAACAGGAGTTGTGCCCCAACTTGTGAAACTCCTAGGGGCTACTGAATTGCCAATTGTGACTCCTGCGCTAAGAGCCATAGGAAATATTGTCACTGGGACAGATGAACAGACTCAGGTTGTTATAGATGCGGGAGCACTTGCCATCTTTCCAAGCCTGCTAACGAACTCCAAAACTAATATTCAGAAGGAAGCTACATGGACAATGTCTAACATCACAGCTGGCCGCCAGGACCAGATACAGCAAGTCGTGAATCATGGATTAGTCCCATTCCTCATTGGCGTTCTCTCTAAGGCAGACTTTAAGACACAAAAGGAAGCTGTATGGGCTGTGACCAACTATACAAGTGGTGGAACGGTTGAACAGATTGTATACCTCGTTCGTTGTGGCATAATAGAACCACTGATGAACCTCTTAACTGCGAAAGATACCAAAATTATTCTGGTTATTCTGGATGCCATTTCAAATATTTTTCAGGTGAATCTTAACAAGGTGGAATTTATTTGAATTTGGGCTTGAT