Transcript asmbl_32089

Sequence
Transcript Sequence for observation asmbl_32089 of TGE0003178:
CGCCAATAGAAAAAGTCGTTGGTGTATGCAAATGAAGGTCCTATGACGCAGAGACGCAGCGTGAAGCGTGGGTATAAAAACGGAGATTCCGGGGGGGTTTGGAGCAGAGCGGTTTGGTCGTTCGTTGGAGCAACTTCTTTGTTTTGGTTGGTGACTGCGGCTCTTCGTTGGGCAGTGGGAGCGGTGCGGCGGTGGGAGAGGCGGCCTAGGGCTTCAGCGTTAGGTGAAAGAAAATGGCCCGAACCAAGCAGACTGCTCGTAAATCCACGGGTGGGAAAGCGCCCCGCAAACAGCTGGCCACTAAGGCTGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAAAAACCTCATCGCTACAGGCCCGGGACCGTTGCGCTTCGAGAAATCCGTCGTTACCAGAAATCGACCGAGCTTCTGATCCGGAAGCTGCCTTTCCAGAGGTTGGTGAGGGAGATCGCCCAGGATTTCAAAACCGACCTGAGGTTCCAGAGTGCTGCCATCGGCGCTCTTCAGGAGGCTAGTGAAGCGTACCTGGTGGGTTTATTTGAAGATACTAATCTGTGTGCCATCCACGCTAAGAGAGTCACCATCATGCCCAAAGATATCCAGTTGGCTCGCCGGATACGGGGGGAGAGAGCTTAAGTGAAGGCAGTTTTTATGGTGTTTTGTAGTAAATTCTGTAAAATACTTTGGTTTAATTTGTGACTTTTTTTGTAAGAAATTGTTTATAATATGTTGCATTTGTACTTAAGTCATTCCATCTTTCACTCAGGATGAATGCGAAAAGTGACTGTTCACAGACCTCAGTGATGTGAGCACTGTTGCTCAGGAGTGACAAGTTGCTAATATGCAGAAGGGATGGGTGATATTTCTTGCTTCTCATGATGCATGTTTCTGTATGTTAATGACTTGTTGGGTAGCTATTAAGGTACTAGAATCGATAAATGTGTACAGGGTCCTTTTGCAATAAAACTGGTTATGACTTGATCCAAGTGTTTAACAATTGGGGCTGTTAAGTCTGACCATGCATCACTGTGATAGAATGTGGGCTTTTTCAAGGGTGAAGATACAAGTCTTAACCACAGTGTAACTTACAGTTTCCTTAAAAAAAGTAAACCTGGCAGCTATAGAATACACTATGTGCATTTATAATAGCTATTTTATATATTGTAGTGTCAACATTTTTAAATTAAATGTTTTACATTCACATGTGGTGGGGAGTCTTGTCATTAAGGTGTGTGTAATTTTAGAGTCCAGTTGGTTTTCTCCTAACTAGAGTGCACTTGTTTTCATAGTAGTAAAATGCTTTGCGCATCATACCTTGCATAAGTCCTCATTCTACCACATGTTAACTAACTCTAGCTGATAATGCAAACACTAACGGGGAATTTTATTTATAAGGGCTCTAGAATATAATACAAGTTATTCACACCAGCATCATCTGTTACTAATCTGAACTAGTTAGTGCAGCTTTTCTTTGTGTTGTGGTTGGTCTCATAACTAGGTTGAGTTTTTCTCTAAGTAGAGGAAACAATACGGAAATTCTTTTCCTTGTGGAGTTTGTATTATAAGGCTTAGAGTAAACTTGTGGTGGGGGAGGGGCACACAGCTCCAGCTTTTCGAACCTCAGCCAGTTAAGATGGCGTCTAGTGAGGTTACATCTGGTATATGGTTCTGGGGAAATCACTTTAGAGATGGTCTTCCAAGTGGTTTTTAAATTTATCCTTCTATTGAAGTTTTTAGGTCAATTATGTATGTTGACTAAATTTACAAATAAACTTGTTTATCCAACTAAGTGTCAAAAACCTAAATTGAATGTACAAACCCACCCATTATCTAGGTCCTTTGTATCTTAAAGTTTGAGTTTAGCTTTTTTAGGTTTTGCTTGGTAGATGAACCTTTTATTTACAAAAATAGTCATAGAAAGCATGTAAAAGTCCCTCTGCTCTGAAAAATGCCATGATTGCTATTTTTTGCAGTGCGGGCTTAAGACGTATTAATATGCTTCCCTTTGCCCCCATGTTGTCAAGGTATAAAAATTTGTCTATTCAAGGTATAACAGGTCAAGGAAAGTAAATTTCTTTAAAATTCGAGGGCTCAAATTTGGTATCTGTTCCAAGAACCTTTTCTGGCAGTATGTAGATCTCTACGTAGCAAATTATTTTAACAGAAGCGCAGAGGTAGAGAATTCATTGGTCTAAGCCACCTTTTCAGTATAAAAACTAGTTTTCTTGACCAATGATGGGCAGCAGTAAAGCTCAGTATATGTCAGCTGGATGTGGGCACAAGAGCCACCAATCATTAGGAGGTGTTCGGTATATTTAAAGTTAGCTGTAGGAACACATTTTTGCCCTAAAGGCTTTTTTAATAAGTTAGCATTAGTTTCAACTTTAAAGGGTTTGTGAAGAAGCTAGCTAGAGTAGCCTTGGGAGTCCTGGTTAAACAGCCTTAGGGGGGATATCAAAGGCGGAGTCCAATACAATACAAAATACAATGAATGGTTTTGTAAAAGGTCCATTATAACCAGTGCTTGGAACAATGACTGACTGAGAACTTATGTTGTTACTTCCGAAGGAAGTTGAAGTCCTAGACATTGGGATATGCTGTGCTCTGGAGTGTGGCAGTGTTTGAACACAAGTAGAAGCAGCTATGAGTTAGCTTGAGTTTCTACCTGTGGTAACAAGCGGGTAACGCTTGAACTTTACGCAGTCTGTGTCTTGATGTAGAAAGTTCTTGAATTTTATTGGGTGACTTGGAATTTGCTGCTTAAATAGTGTAACACTTCCATACTTTACTTGAGCACACATCACAGAAGGCAAAAATATTTTTTGGTTCTAGGAAGGTACCCACACAGGAGATAATCTGGGTATAGGTGATGGAACAGAGTCTGTAAGGAGAAAAGCAAAAATTGGAGCTGATGAAAGGTATCCTGTGCCCTTGATGGATGAGACAAAAATAAAGTTTTTGAAGTTGCAGACTTT