Transcript asmbl_32053

Sequence
Transcript Sequence for observation asmbl_32053 of TGE0027210:
CTTGGCCCCTAGAGTTTCTGATTTAATAATAGGTCAGGGTGGGGACAGTTACTATATTTCAAACGAGTTCCCAAGCGATGCCGATGCTACCGTTCTGGGGACCGCATTCGAGAACCACTGGCCTAAACTGCCTCTTGGGATTAACAGAAGGAAGCCTGAGTCCCATGTTCCTTCTCCAGGTGAAGCCCGACGGCACGTACGTGAAACCCGTGAGTAACAAGCTGACCTACGGGACCATGGTGTTTGTCAGGTCCCTCCTTGTGAAAGATGCCGCTCAGTGCCTATCGAAGGCGTGCACCATTGCCATCCGGTACAGCGCCGTGAGGCACCAGTCTGAAATCGAGCCAGGTGAACCAGAACCACAGATTTTGGATTTTCAGACCCAACAATATAAACTCTTTCCACTCCTGGCCACTGCCTATGCCTTCCATTTTGTGGGCGCATACATTAAGGAGACCTATCATCGGGTTAATGAGGACATTGGCCAAGGGGACCTGAGTGAGTTGCCCGAGCTTCACGCGCTCACTGCCGGGCTGAAGGCGTACACCACCTGGACGGCGAGCAGTGCTATTGAAGCTTGTCGGATGGCTTGTGGCGGCCACGGCTTTTCTCACTGCAGCGGTCTCCCCAGTATTTACGTCACTTTTACCCCAACCTGCACCTTCGAGGGAGAAAACACTGTCATGATGCTGCAGACGGCTAGGTTCCTGATGAAAAGCTATGACCAGGTGCGCTCAGGAAAGCTGCTGTGCGGCCTGGTGTCCTACTTGAACGACCTACCCAGTCAGCGCATCCAGCCACAGCAGGTGGCGGTCTGGCCGGCTGTGCTGGATATCAGCAGCCCCGACAGCCTGACGGAAGCGTATAAACTCCGAGCAGCCAGATTAGTAGAAATTGCTGCGAAAACCCTTCAAGCTGAACTGAGTCACAGAAAAAGTAAGGAGGTCGCTTGGAACCTCAGTTCCATCGACCTTGTTCGAGCAAGTGAGGCACATTGCCACTATGTGACAGTTAAGCTCTTTTCAGAAAAACTCCCCAAAATTCAAGATAAATCCATCCAAGCTGTCTTGAGGAATTTATGTCTCTTATATTCTCTGTACGGAATCAGTCAGAAGGCAGGGGATTTTCTTCAGGAGAGCATTCTGACAGACTCTCAAATTGCCCAAGTACACCAGCGTATCAAGGAGTTACTGACCGTCATTCGCCCAGATGCTGTTGCTTTGGTTGATGCGTTTGATTTTCAGGATATGTCACTGGGCTCTGTACTTGGCCGCTATGATGGGAATGTGTATGAGAACTTGTTTGAGTGGGCCAAGAAATCCCCACTAAACAAAGAAGAGGTCCATAAATCTTTCTACAAGTACCTGAAGCCTTTGCAGTCCAAACTCTGAATGTCACGACGAGTTTATTCTGCCCCAGGAAGCAGCTGTACTCTGCTGCTCCCCTGGTACCTGCCACACAAATCTACGCGGAATCTTTATCGAATTCGGAGAGCTATAGAGCAAATGATAAATTGGCCCCTTTCCCATCTATAAATAAAAAAATGAACAGCTTACAGAAATTAAATGAAAAAAACATGTTTTTAAGTGCAATTAACACTGAAAGAGACCCGTTAAGCATTCAGAAAAAGCTTTGAGAAATGTACTCTGACTTCCATATGTACAGCTGCTGATCCCAGGAGGCCATAACTTACGATAATTAGTAAAACTTAACTACTGAGTAGTTAATTATTTTCACATCTTAATTGCACATCACTGGATATATGTGTTTTTAAGCAAAGGTATTTTTAAAAGGGTACAACCCTTCCAAGTTTTCCTGCTTAGTGTCCCTGTCACTACTGTCATGGGCCTTGGCTTAAAAGCAGGACCCGAGGCTGGATTGGGGGAAAGAAACCAATCAGAAACTTTAGTGTGAGTTTGTGCTTAACTCATCTTCTGCCTGCTTGCCCTTGGTTGCTGACATAATGTTTCTGTTTGTTCATAGTAGCATTTTTCCTACACAGGGATTTCTTCAGCACAGAGCTACTACAGGGTCATTGTCCTATGTGACTGGGAATCGATCTTCCACTCGAAGGATCCTAAAATTGTCACTGTAGTAGCACTGCAACTCCCTGTGTCCCCAACTTCTAGTGGAGGGGTAGGTAGCAAAGTTATCTCTACATAGGACTTTTGGCAGCTAATGGGACTCAGTCAGTGGTGTTTGATCTCCCTCCATCCCTGTCCCTTAACCTCTCCTGAAAGAGATGCCGGAGGAGAAGAGAGTCACAGTTCCCTCCTAGTAGAATATGTATAGGGAAAGCTCTCGGTTACGGTTACGGTAACTTTGGGTACCATAGTAACTGGTAGATTTCATATATTCTGTTATATTGGCATAAACCATTAAAATGCTTGGAAGTTACAGTACCTTGCATTAGGAAAGTAAAATCATATTTCAGGTTAACTCTTAGACCCAGGGGTAGCACAGAAAAATCTTTTGACAAACCATGTGTTCTGATTTTTGGATCAGAAAATATAATCTTTGAAGGATAAAGGATAAATGGGACTTCCATAGGATCTCTTTCTTTTTTTCGTTTAGGTGAGGCAACACCCTTGGTGGACCTCAC