Transcript asmbl_32044

Sequence
Transcript Sequence for observation asmbl_32044 of TGE0004682:
TAGAAGAGACATAATTTCCACTCATTTTACCATGGTCACTCATATCCACAGTTAAAACTTGGCTGACTTTTTAAAACTGTTTTCCAGGCATTGATCACTCAGACTCGAGCCAAACAGGCAGCGACCATGAGCGAAGTGGAGTGGAGAGGGAGAGCGGTCCCGGTGAAGATCGACAGAGTGCGGATCTTTTTGTTGGGGTTGGCCGATAACGAAGCAGCCATTGCCCAGGCTGAGAGCGAAGAAACCAAGGAACGTCTGTTTGAGTCTGTGCTCAGCGAGTGTCGGGACGCCATCCAGGCCGTGCGGGAGGAGCTCAAGCCCGATCAGAAGCAGAGAGATTACACCCTCGAGGGAGAGTCGGGGAAGGTGTCTAATCTTCAGTACCTGCACAGCTACCTGACCTACATCAAGCTGTCAACGGCGATCAGGCGGAACGAGAACATGGCCAAAGGTCTGCAGAGGGCCCTTCTGCAGCAGCAGCCGGAAGACGACAGCAAACGCTCCCCCCGGCCGCAGGACCTCATCCGGCTCTACGACATCATCCTGCAGAATCTGGTGGAATTGCTCCAGCTTCCTGGCTTAGAGGAGGACAGAGCCTTCCAGAAAGAGATAGGCCTCAAGACCCTGGTGTTCAAGGCTTACAGGTGTTTTTTCATTGCTCAGTCCTACGTGTTGGTGAAGAAGTGGAGCGAAGCCCTCGTCCTGTATGACAGAGTCCTAAAATATGCAAATGAAGTGAATTCTGATGCTGGGGCCTTCAAGAATAGCCTGAAAGACCTGCCTGACGTGCAAGAGCTTATCACGCAAGTGAGGTCAGAAAAGTGCTCTCTGCAGGCGGCGGCGATCCTGGATGCAAGTGACTCCCACCAAACAGAGACTTCCTCTCAAGTCAAGGAGAATAAGCCCCTGGTTGAGCGGTTTGAGACCTTCTGCCTGGACCCTTCCCTCGTCACTAAGCAGGCCAACCTCGTGCACTTCCCTCCGGGATTCCAGCCCATCCCTTGCAAGCCTTTGTTCTTTGACCTGGCGCTCAACCACGTGGCTTTCCCACCCCTCGAGGACAAGTTGGAGCAGAAGACCAAGAGTGGGCTCACCGGGTACATCAAGGGCATCTTTGGATTCAGGAGCTAACCACTCTTTTCCTTGGGGGCAGGGGGTAATTCTGACTCGGTCTGTATTGTGAGAAAACTCTAGCAAGTCTGTGATATTAAATCCAGGTCTGCGTTGGCCCAGGGCGGGAGTGTAACATCCTCAGCCCTGCGTTCCTATGTCTGTGTGTGTGCGCTCATGTTCTTAACCGGTGTGCCAGGAGGGCACCCTGTTGTCTTCTGGTGGATGTGTGCGGGGTCCCTCTGTCCATACCTCCCGGAGGAGGGCCGCTGCCATCTGGGCCCGTGCGAGCTGTGATTGTTTACCTCTGGTCCGTAACGTGTTCGGGAGGAGGTCCACTCCAGGCACCGCGAGCGCTCGGAAAGCTTTGCTGCGTTTCTTCAGTGCTGTGGACTTAAAACACACTCCTCCTCGCTGTGAGCATCCAGGACCCTTTGGAAAGTTTGTTCGTGACTAGGAAACACTGGCAACGTCCCCCCAGAACGACAGTCAGCCTCCCCCCTTCACTGCCAAGTGAAAGTTCAGAAGTTTCAGAACAAGCAAAGAGCTCTATTTTTAGAAGAAATATGTTATACTCAGAATTGATGAAAACAAATCTTATATTAAAAGGCAAAGATGCTGGA