Transcript asmbl_32036

Sequence
Transcript Sequence for observation asmbl_32036 of TGE0004678:
GGCTGCGGCACGGCTCGCCCTGAGCTCCGGGTCCCACAGAGCGCGTCGCGGCCTTTCGTACGAGGAGGCTGGGCATCTTGGACCGCTCCCCTCCTCTGCCGGGTTCCTTGGCATCTTCTCCGGCCGGACCCCCGGGCCTCGCGGCCCCCTCAGTCGGCACCGTTCCCGGCTGCAGCCCCGCGCGGGCCGGCTGTAACCGCGCCGCGGGCCGGACGATGCCCAGGAAGCTGCTGCTGCTGCCCCCGCGCTCCGTGCCCTCGGCTTTCCGCGCCCCGCGAGCCAGCTCCTCCGCAAGCGCGGCCATGAACGCCGCCCGCACCGGCTACCGAGTCTTCTCGGCCAACTCCACGGCCGCCTGCACCGAGCTGGCCAAGCGCATCACCGAGCGTCTTGGTGCTGAATTGGGGAAGTCTGTGGTATATCAAGAGACCAATGGAGAAACAAGAGTTGAAATAAAAGAATCTGTTCGTGGCCAAGATATTTTCATTATACAGACAATACCCAGAGATGTGAATACAGCTGTGATGGAGTTGCTGATCATGGCTTATGCGCTGAAGACGGCCTGTGCCAGGAATATTATCGGAGTCATCCCTTATTTCCCCTACAGCAAGCAAAGCAAGATGAGGAAGAGGGGTTCCATCGTGTGCAAGCTACTAGCATCCATGCTGGCGAAAGCAGGTTTAACTCACATTATCACTATGGACCTTCATCAAAAGGAAATACAAGGCTTTTTCAGCTTTCCCGTGGACAACCTTAGAGCCTCACCTTTCCTGCTTCAGTATATCCAGGAAGAAATTCCAAATTACAGAAATGCAGTCATCGTAGCGAAGTCTCCTGATGCTGCAAAAAGGGCCCAGTCATACGCTGAGAGGCTCCGTCTGGGTCTAGCCGTGATCCACGGAGAAGCACAGTGCACAGAGCTGGATATGGACGACGGTCGTCACTCACCTCCGATGGTCAGAAATGCCACCGTCCACCCGGGCCTGGAATTGCCGTTGATGATGGCCAAAGAGAAGCCACCGATAACTGTCGTCGGAGACGTCGGAGGGAGCATCGCGATCATAGTGGATGACATCATCGACGACGTGGAAAGTTTTGTCGCTGCGGCAGAGATCCTGAAGGAGAGGGGCGCTTACAAGATCTACGTCATGGCCACTCACGGCATCCTGTCCGCAGAGGCCCCCCGCCTCATCGAGGAGTCCTCCATCGATGAGGTGGTGGTGACGAATACTGTCCCTCACGAGGTGCAGAAGCTGCAGTGTCCCAAGATAAAGACTGTGGACATCAGCCTGATTCTCTCTGAGGCCATTCGGAGAATCCACAACGGAGAGTCCATGGCGTACCTCTTCCGGAACATCACTGTGGACGACTAGCTTTCTCTGGAACTCCTGAGACGCGTGGGAGGCGGCAGCAGTGTGACGTCCGCAGCGTTTCCTTGCAGGGGACTCGGGTGGTCTCGTGCCGTTCGCTTTGTAGGAGGCTTTAAGATAGTCGAGGGGGAGACACAGCTAATGGGTAAAGGGCCTTAAACGTCTGCCCTCACCATCCCGTCCCTCAAACAGAAGTCACATTTTCCTGAAAAGAACCTGAACATCTTCTGACACTGCAAAGGCGTTAGAGGCAGAGACAGTGCTAACTCTGGTGTCCGTTCAGCTGTTTCGGCCGCAGGGAGACGTGTGTTCACGTTGAACTTGGGCGGGCAGCTGGGCGCCCCGGCTCTGTGCCTGCTGCAGTTGTCCTCTCCCTGGCCAACTGCACGTAAACCTTTTGTAGAGAACCGTGTTTTCCTCTGAGAAGCTGCTGTGCGTACAGCCTCTGAACCATAAAGCATTTAGCGTCATCCCCAGCAAGGCCCTAGATAGAGAATAAGACCCTGTCTCTCGGTGTCTGCATTGCTCTTAAATTACAAATAAAGGAATTTGTTATCTTG