Transcript asmbl_31962

Sequence
Transcript Sequence for observation asmbl_31962 of TGE0004667:
ATCATTCGTGTTCAGTCCCCGGATGGGGTGAAGCGGATCACGGCAACAAAGAGAGAGACAGCTGCGACGTTCCTGAAGAAGGTCGCAAAGGAGTTTGGCTTCCAGAATAATGGCTTCTCAGTTTACATCAATAGAAACAAGACCGGAGAGATAACAGCATCGTCCAACAAATCCCTCAACCTGCTAAAGATCAAGCATGGCGACTTGTTGTTCCTATTTCCCTCGAGCCTTGCCGGACCGTCATCTGAGATGGAGACGTCCACCCCGCCGGGCTTGAAGGCCCTGGGCGCGCCCACCGTGGTGGAAGATGAGATCGACCAGTACCTCAGCAGGCAGGACGGCAAGATCTACAGGAGCCGCGACCCGCAGCTATGCCGACACGGCCCTTTGGGGAAGTGCGTGCACTGCGTCCCTCTAGAGCCATTCGATGAGGACTACCTAAACCATCTCGAACCGCCCGTGAAGCACATGTCCTTCCACGCCTACATCCGAAAGCTGACCGGAGGGGCTGACAAGGGGAAGTTTGTCGCCCTTGAGAACATCAGTTGCAAGATTAAATCAGGGTGCGAGGGACACCTTCCGTGGCCTAATGGCATCTGTACTAAGTGCCAGCCGAGTGCCATCACGCTGAACAGACAGAAGTACCGACACGTGGACAACATCATGTTTGAGAACCACACGGTCGCTGACCGCTTCCTCGACTTCTGGCGGAGGACGGGGAGCCAGCATCTCGGGTACTTGTACGGGCGCTACACGGAGCACAAGGACATCCCTCTCGGCGTCAGGGCCGAGGTGGCGGCCATTTATGAGCCTCCTCAGATTGGTACACAGAACAGCTTGGAGCTCCTTGAAGACCCAAAAGCCGAGGTGGTGGATGAGATCGCTGCCAAACTTGGCCTGAGGAAGGTTGGCTGGATATTTACGGACCTTGTCTCAGAGGACACCCGAAAGGGCACAGTCCGATACAGCCGGAATAAGGACACCTATTTCTTGAGTGCAGAAGAATGTATCACTGCAGGAGACTTCCAAAATAAGCACCCCAACATATGTCGGCTCTCTCCAGACGGACACTTTGGATCCAAGTTCGTTACTGCTGTGGCTACAGGTGGCCCCGACAACCAGGTCCACTTTGAAGGGTACCAGGTGTCCAATCAGTGCATGGCGCTGGTCCGTGACGAGTGCCTGCTGCCGTGCAAGGACGCCCCTGAGCTCGGCTACGTCAAGGAGTCCAGCAGTGAGCAGTACGTGCCCGATGTGTTTTATAAGGACCTAGACAAGTTCGGCAACGAGATCACCCAGCTGGCCCGGCCCCTGCCCGTGGAGTACCTGATCATAGATATCACAACAACTTTCCCCAAGGATCCAGTTTATACTTTTTCTATTTCGCAAAATCCGTTTCCTATTGAAAACCGGGATGTGCTGGGTGAGACACAGGACTTCCACAGTTTGGCCACCTACTTGTCCCAGAGTACCTCAGCTGTATTTTTGGATACCATCTCGGATTTCCACCTCCTGCTGTTTCTGGTCACCAATGAAGTCATGCCTCTGCAGGACAGCATCAGCTTGCTGCTGGAGGCCGTGAGGACCAGGAACGAGGAGCTGGCGCAGACCTGGAAGAAGTCTGAGCAGTGGGCCACCATTGAGCAGCTCTGCAGCACAGTCGGAGTGCAGCTTCCGGGCCTCCAGGAGTACGGTGCCGTTGGGGGCCCCTCGCACGCCGCCGCGGCCGCCATGTGGGCCTGTCAGCACTGCACCTTCATGAACCAGCCGGGCACTGGCCACTGTGAGATGTGCAGCCTCCCCAGGACCTAGGGCTTCTGCCCCTGTGGCGGGGCCGGGCCCCTAGCCCTCCCTGAAGCCAGGACCTTTGTGACCGTGCCCCTTGGGCAGCCCTGAGGGGCGAGGCAAGGTAGCTGCCCCCCGGGTTCCTGATCCACAAGGCTTCTCAGCATCAGGCTTCCCTGGAGGAGGGCCCGGCTGGTGCTCTGCCAGCTGCTGGCAGCCACCTCGGGCAGGCGCAGCCCAGACACCTCTGGTGTCAGCCCCACCGTGGTGGAGGGACTGGCACCCCATCTTCACCCGGAGCGGAGGGGCGGGGCGCTCGCTGCTGCCTTGGCCTCCTTTCTCCTTCTGGATGCTTTCTGTTCTTGCCTCCCCCTGGTTTGGTGGGGGTCCCCCTTGGCCTCTCCATCCTGCTGCTCTGGGGCAGACCCTACCCTGAGGCCACTTCCTCCCTTCCCGGAGCCATCATCCGGTGGAAGTGCGAGTGGCCTCCGGCTCGCTGGCCTCCCTCTGCTTGATCTGCAGGTTGATTTGCTGCCCACCCTCTCTCCTGCTCCCGCCTGCCGTTCAGGTGGGATTTTAAAGTCGGCATTGGTTGTAATAACAGTTATTAGTAATTTCTGCCCAGAAGACTTTTATTTATTTTTTTTAAGATAAAAAATGCATAAAAGGGGAGTGAGAGAGACTAGTTTCCTCTTCCTTCTCTCCTCTAGTGAGTCCCCGTGGGTGTGTGCAGGGCGGGTGAGTGTGGCAGGGGACTCACAGTCAGTTCTCCATGGAAGCTAACCTCAGTGCCTGAGACTTTTCTGCCAAGCCACACAGCTGCAGGTACGGGCCGACCCAGCAGGAGTGGCGCGGTGGCTCCACCAGGCAGGTGGCTCCACCAGGCAGATGGCCCCTGCAGACGGCTGATGCCCCTGACCAGGCCCACATGGGGTGAGCCGAGTTAGCCAAGGTCAGAGCTCGGGTTCCCTTTGCCCCACACAGTCCCATAGCCCTGCCTGGCCCCTGGTCTCTGGCACAGTGACGTGGCCATCAAGAAAAGGAGCAGGGGCTTGACCTGTCGTGAGCGCACATGGGTCGGCTGTGGGGGCATCGGCAAGTTGCTGCTGTGCTGATGGAGTGAGGTCCGCACCCTCCCAGGACAGAGATCTGGGCAGACCTCGCACATGTGCCCTGTGGTCCCGCATTCTCTCCACGGCTGGGGTGTGTTCAGGCCCTTCCCCAGGGACTCGTGGGCATGCTGATGCCTCTTTGCCTTAACAAGAGCCGTATCTCTGAGCTGCCCCGCACCCATGGGAGAGGCCAACCAAACAGACTGCTTGGGGACTTCGGGTCTGCCCTGGGTTGGGGGCCAGCCTGTGGGACCCTCCCTTTCCCTCGGGGCTGTGCACAGAGCACTGAGTGTTGGCTTCTGCCCTAGTAAGGGCCACATCAGGCACCTCCGGGTCCACCCACCCAGACTCGTCTGCTCTTGGGGCCAGGGGCCAACTCGGCTGGGTCTGGCGGTGGCAGAGCAGCTGACCTGGAGGGGCCGGAAGGGCAGAGCAGCCCGGCAGAAGCGCAGCAGCCTGGCGAGGACTGGCTGGGGGCACTCTCAGCAGGTGCCCTGGCTGGAGCTCCTGCCTCATCTTCTGGTCCCTGCAATCAGATGCGAGGCCGCGCTGGGCCCTGCGTTCGGCCTGTCCCCCGGCGCCGGGGGAGGCCGGAGGTACCGGCTTCGAGAGCACCGGCCCCCCTCCCGCCTGCTCTGTCATCACCAAGCTAGTTTCGTTTTCAACCAATACTTCACTCGGAAGCTCTGGCATCGCATCATTCATTTGTTTCCTTCTGTCTTTTAGCTAAAGAAAAAGCTTTGTTGTGATTTC