Transcript asmbl_31951

Sequence
Transcript Sequence for observation asmbl_31951 of TGE0004664:
ACCCCTGGGGCTGGGGACCTGGGTGACTCAGGACAAGCAGCAGAACTCGAGGCGACTCTGAGCTGGGGTTGCTGCGTCTCTCTGGGGGCAGGCTGCAGGTCCCATGGGTCCTCAGACTGTCTCAGCAGGTCCCCAGAGGTAGGCAGGGCAGAGGTCAGTGTGGCCCCGCTGGGCTTCAGGAGCCTGCATCCGGGCCCTTTACAGATGCCTGGCTGCAGCCGCCCACCTGCTCTGGAAGGCGCGTTCCCCCTCGGGTGCAGACGCGGGGCCTGACCACCTGCAGAGGCCTCGTGGGAAGGGGAGACACCGGCCCCCTCCAGGTCACCATAGTCTGTCCCACCCACAGGTGTGGCAGATCCAGCTAGAGGCAGCATGGCCGAGCAGGAGCCCACCGCCGAGCAGTTGGCGCAGATTGCGGCGGACAACGAGGAGGACGAGCACTCGGTGGGCTACCGGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGTCTGCGCAAGTACAAAGAGGCCCTGCTGGGCCGTGTGGCTGTGGCCGCTGACCCCAATGTCCCCAACGTTGTTGTGACCCGCCTGACCCTGGTGTGCAGCACAGCCCCGGGCCCCCTGGAGCTGGACCTGTCTGGGGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAAGAGGGTGTGGAGTATCGGATAAAGATCTCTTTCCGGGTGAACCGAGAGATCGTGTCCGGCATGAAGTACATCCAGCACACGTTCCGGAAAGGCGTCAGGATCGACAAGACCGACTACATGGTGGGGAGCTACGGGCCGCGCGCCGAGGAGTACGAGTTCCTGACGCCCGTGGAGGAGGCGCCGAAGGGCATGCTGGCCCGCGGGAGCTACAACATCAAGTCCCGCTTCACAGACGACGACAAGACTGATCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGAGTGGAAGGACTGAGCGTAGGCCTGGAGGCAGGCAGGGTGATGGCGGGGCGCACCCCCCACCCCTCCCCCACCCCCATACCAAAGTGCTGACAGGGCGCCTGCCCACGCTGCGGTCTTTCCCCCTGGTCCGCCTCCCGGCCAGCCCGGCCCCCCTCGACCCTCCCCAGCCTGCAGCCCCCAGCCTCCTGGGTGGTCTCGTGTCACTGCTGCTTCATTCTGTGCTGTGAGGGGAGGACGGCCGTAGCCCAGGCCTCCCCCTCCCCCTCTGTGTCCCTCCACGTTCCCCCACCTGTCCTGACCCCGCCTGAGGCCCTGGCTTTTCCGAGGCAGTGGGGCATTGGATGGGGTCTCGTGGTTTCAGTTGCCCCAACTCCCATCGTCTCCCCCTGCGGGGTGGGGGTGGGGTGCATGATGCAGGGCCTTGTGGGGACCAGCCGTCCCCCAGCTGTCACTCTTCCCTGGTCAGCTTGCCCACCGTTGTCAGTAACCATCTAACCATGATGCCTTAACATGCAGAACGTGTGCGTGGGGCCGTCACTAATCTCTGACCCCTGTGTCTGCATGAGCATGTGGTCTCCCCCAGTCCCTTTCCCAGCTGCAGTCCCGGTCGCCCAGGGAGGTGTAGGATGTGCTGCTGCTGTTCCCCGGCCTGCCAGGGCCTGGCCAGCCCCCTCCCCGTGGCCCTCCCCTAGCCCGGGCTGTGGGGACAGTCCCAGGCGCTTAGGGAAAGCCAAATTGCCAAAACTCAAGTCGCCTCCAGTCTCATCGGGGAGGCTGGGTGTCCTCATGCCTCTGCCTTCTTTGTCCCAGTGGGCAGCACCCAGACCCAGACCCCACAGCCCCGACAGACAGCCCTCGGTGGACAAAGCCAGCAGCCGAGCCTTACTTGTCCCACCTGGGCCCACCGGCCTGGAGTGGCATGCCTGGCCTGTCAGTATTTATTGCCTCCATATGTGCCGTCCTCTGGGCCCGCTGGCCTGCCACCTCTGCCCCCAGGCTCGGTGCCACCATCCCTGGCAGGCCCTCCCCGGACCCAGCCAGGACACCCGTGGGACCAAGCATGCACAGTCGGAGCTGTCCCCTGTGCCACCCCTCCCCTCGCTGGTCAGGCCCGGGCTGGAACACAGGAACCCGTCCCTGCTTCTCCTTTTCAGACCAGGAAATAAACTCCCCCCCAGAGG