Transcript asmbl_31913

Sequence
Transcript Sequence for observation asmbl_31913 of TGE0027194:
CCCGGGCCGGCGCGCAGCCCAGCCCATCAGCCAGCCCCGACCCTCACCCCTAGGCCGCGATGTCCGAGTTCGTGGCCCAGCTGAAGCAGGACGGTGTGTTCGCCAAGGAGGTGCGGACGGGTGGCCTGGCCTTCCACTCCTACTTCATGCAGGACATCGCGCCCTCGCTGCTGCAGACGCTCAAGAAGGTGATCCGGCAGCCGCGGCCCCGCTCTGCGCGCTGGCTCAGCACGAGCATCCCCGAGGCCCAGTGGCAGAGCAGCTTGGCCCGCACCTGCTCGGCCGAATACCACGTGAACAACCTGGTAAGCCCCGTGCTGTTCCAGGAGGCGCTGTACCACGTGCCCGAGAACGCCGTGGTGCTGGAGGTCAGCCCCCACGCCCTGCTGCAGGCCATCCTGAAGAGGGGCCTCCGGTCCAGCTGCACCGTCATCCCCCTGATGAAGAAGGAGCACCCGGACAACCTGCAGTTCTTCCTCAGCAACATGGGCCGGGCCCACCTGGCAGGCATCAACATCAACGCCAATGGCCTATTCCCACCCGTGGAGTTCCCAGCTGCCCGGGGGGTTCCCCTCATCTCCCCCCACATCAAGTGGGACCACAGAGAGACCTGGGACGTCCCCAGTGTGAAGGACTTCACCAGCAGCTCCAGCGGTGGGGGAGCCACGGTCTACAACATCGACACCAGCACGGAGTCCCCCGACCACTACCTGGTGGACCACTGCATTGACGGCCGCGTCATCTTTCCCGCCACTGGCTACCTGTGCCTGGTCTGGAAAACTCTGGCACACGCCCTGGACCAGAACGTGGAGCAGATGCCCGTGGTTTTTGAGGATGTGACGCTGCACCAGGCCACCATCCTGCCCAAGACAGAGATCGTGGCCCTGGAGGTGCGGCTCCTGGAGGCCTCCCATGCCTTCGAGGTCTCCGACAAAGGCAACCTGATAGTGAGCGGGAAGGTGTACCAGTGGGAGGACCCCGACCCCAAGCTCTTCGACAGCCAGGGTGGCCTGGCTCCAGAGGCGCCGACAGGCCCAGAGGCAACGTCCCGCCTGGCCCCGGGGGACGTGTACAAGGAGCTGCGGCTGTGTGGCTACGACTATGGCCCCCAGTTCCAGGGCATCCACGAGGCCAGCTTTGAAGGCAACACAGGCAAGCTCCTGTGGAGGGACAACTGGGTGGCCTTCCTGGACAGCATGCTGCAGATATCCATCCTGGGCACCAGCCAGCGCAGCCTGCGCCTGCCCACCCGCATCGCTGCCGTGCACATCGACCCCGCCACCCACCGGCAGAAGGTGTACGCCCTGCAGCGCGAGACGCAAGTGGTCGACGTGGTGGTGGACAGGTGTCTACAGAGCACGGTGGCCGGGGGCGTTCTCATCTCGCGGATGCACACCTCGGTGGCCCCGAGGCGGCAGCACGACCAGTCGCCCACCCTGGAGAAGTTCTGCTTCACGCCGCACCTGGAGGCCCGGTGCCTGGTCAAGAGCGCGGCCCTGCAGGAGGAGCTGCAGCTGTGCCGGGGGTTGGCGCGAGCACTGCAGACCAAGGTGGCCCAACAGGGACTGAAGATGCTGGTGCCTGGGTTGGATGGGGCCCAGGCCCCCCGGGAGCCCCCGAAACAGGGCCTGGCCCGGCTGCTGGCGGCCGCCTGCCAGCTCCAGCTCAACGGCAACCTGCAGCTGGAGCTGGGGCAGGTGCTGGCACAGGAGAGGGCCCTGCTGCATGCGGACCCCCTGCTCTGTGGCCTCCTGGATGCGCCGGCGCTCAAGGCCTGCGTGGACACCGTGCTGGAGAACATGGTCAACTTCCGGATGAAGGTGGTGGAGGTGCTGGCTGGTGACGGCCACCTGTACTCCCGCATCCCGGCCCTGCTCCGCATCCATCCCATGCTGCAGCTGGACTACACAGCCACCGACCGCCACCCGCAGGCCCTGGAGTCTGTCCAGGCCAAGCTGCAGCAGCATGGCGTGGCCCAGGGCCAGTGGGACCCCGCAGGCCCCACCCCCAGCGGCCTGGGCCCGGCAGACCTCCTGGTATGCAACTGCTGCATCTCCAGCCTCGGGGACGTGGCCACGGCCCTCAGCAACATGGCGGCCACCCTCAAGGATGGTGGCTTCCTGCTGCTGCACACCCTGCTCAGAGGACACCCCCTCGGGGACACGGTCGCCTTCCTGACCTGCCCCGAGCCGCAGCCTGGAGGGCAGAGCCTCCTGAGCCAGGATGAGTGGGAGAGCATGTTTGCCAAGACGTCTCTGCGCCTGGTGGCCCAGAAGAAATCTTTCTACGGCTCCGTGCTCTTCCTGTGCCGCCGGCTGGCCCCTCCGGAGAGCCCCATCTTCCTGCCTGTGGAAGACACCAGCTTCCAATGGGTGGACCCGCTGAAGGACATTCTCTCCGCGGCCTCCTCCCAGCCTGTGTGGCTGACTGCAGTCGGCTGCAGCACCTCGGGTGTCGTGGGCATGGTCAACTGTCTTCGCAAGGAGCCCGGCGGGCACCGGGTCCGGTGCATCCTGCTGTCCAACCTCAGCAGCACGTCCCCCGTCCCCAAGATGGACCCGAGCTCCCCAGAGCTGCAGAAGGTGCTGCAGGGGGACCTGGTGATGAATGTCTACCGGGACGGGGCCTGGGGGGCCTTCCGCTTCTTCTTGCTGGAGCATGACCAGCCGGAGGAGCAGACGGAACATGCCTTCGTCAACGTCCTCGTCCGAGGGGACCTCTCCTCCATCCGCTGGGTTTGCTCCCCGCTGCGCCACGCCCCAGCCCCCCGCCCCGGCTCTCGCCTCTGCACCACCTACTACGCCTCCCTCAACTTCCGGGACATCATGCTGGCCACGGGCAAGCTGTCCCCTGACGCCATCCCAGGGAAATGGGTCAACCGGGACTGCATGCTGGGCATGGAGTTTTCCGGCCGTGACGCCAGCGGCAAGCGCGTGATGGGGCTGGTGCCCGCCGAAGGCCTGGCCACCTCCGTCATGCTCTCTCAGGACTTCCTGTGGGACGTGCCCTCCAGCTGGACCCTGGAGGAGGCGGCCTCGGTCCCTGTCGTCTACACCACCGCCTACTACTCGCTGGTGGTGCGCGGGCGCATGCAGCGCGGGGAGACAGTGCTCATCCACTCGGGCTCGGGCGGCGTGGGCCAGGCCGCCATCGCCATTGCCCTCAGCCTGGGCTGTCGTGTCTTCACCACCGTGGGTAAGCCGGCCAGCCCTTCCCGGAGCCCGGGGCTACCCGGCTGACCCTGCCGCCTGGCTCACCGGCGCGGGC