Transcript asmbl_31704

Sequence
Transcript Sequence for observation asmbl_31704 of TGE0004630:
AGGTCACCATGGCTGCTGTTGGCTCCTTTGCTGTCCCCAGCTGTCCCCCAGGTCACCTCCCCTCCTTGCTGCCTGTGTCCAGAGAGCGTGCACAGGTTCCAGTGGATCAGAAACCTGGTTCCAGAGTTTGGAGTCTCCAGCTCTCACGTCAGGGTGCTGTCTTCTCCCGCAGAGTTTTTTGAGCTCATGAAGGGGCAGATAAAAGTAGCCAAGAGGCGGGTCGTGATGGCGTCCCTCTACCTGGGGACAGGTCCTTTGGAACAGGAGCTGGTGGATTGCCTGGAAAGCACTCTGGAAAAGTCACTCCAAGCGAAGTTCCCTTCAGACCTTAAGGTGTCCATTCTTTTGGACTTCACACGGGGATCACGAGGTCGGAAGAACTCTCGCACGATGCTGCTGCCACTCCTGCAGAGGTTCCCGGAACAGGTCCGGGTCTCCCTCTTCCACACCCCGGACCTCCGCGGCCTGCTCCGGCTCCTGGTCCCGGAGCGCCTCAATGAGACCATCGGCCTCCAGCACATTAAAGTGTACCTCTTTGACAACAGTGTCATCTTGAGCGGCGCCAACCTGAGTGACTCCTACTTCACCAACCGCCAGGACCGCTACGTGTTCTTGCAGGACTGTCCCGAGATCGCGGACTTCTTCACGGAGCTGGTGGACGCCGTGGGGGACGTGTCCCTGCAGTTGCAGGGGGATGACACGGTGCAGGTGGTGGAGGGTATGGTGCATCCTTACAAAGGTGACCGGGCTGCATACTGCAAGGCAGCCAACGAGCGGGTCATGGGTGTGGTCAGCTCGGCCCGGGCCCGCCAGCAAGCGCTGCATGCCCAGACTTTCCACAGCGACTCCCTGTTGACCCAGGAAGACGCAGCAGCCGCTGGTGACCGGAGGCCAGCCCCCGACACCTGGATTTACCCTCTGATACAGATGAAGCCCTTCGAGATCCAGATCGACGAGATTGTCACCGAGACCCTGCTGACAGAGGCTGAGCGCGGCGCCAGGGTCTACCTTACCACCGGCTACTTCAACCTGACCCAGGCCTACATGGACCTGGTCCTGGGCACGCGGGCTGAGTACCAGATCCTGCTGGCCTCCCCGGAGGTGAACGGTTTCTTCGGGGCCAAGGGGGTGGCGGGCGCCATCCCAGCGGCCTACGTGCACATCGAGCGGCAGTTCTACAGTGAGGTCTGCAGCCTCGGGCAGCAGGAGCGGGTCCAGCTGCAGGAGTACTGGCGGAGGGGCTGGACATTTCATGCCAAAGGTCAGTCCACCGGGACCTGGAGGCCCAGATCGCCATCGTGACGGAAAACCGGGCCCTGCAGCAGCAGCTTCACCAGGAGCAGGAGCAGCTCTACCTGAGGTCAGGTGCCGTGTCCGCCGCCACCTTCGAGCAGCCGAGTCGGCAGGTGAAGCTGTGGGTGAAGCTGGTGACTCCGCTGATTAAGAACTTCTTCTGAGGATGACAGGGATGGCCTTGACGAAGATGACGGGCATGGCTGGCGTCAGCTCCTTCAGCCGCGCTTCGGCGATGACCCCGGTCTGGGTGTCCCAGCGAGCTCCTGCAGGGACAGTGCCGCAGTGAGGGCCGGCATGGCCCGGAAGCGACAGGAGCCCGGCCTTGATCCCCACCTCTGCAGAGACAGGTTGGTGCCCGAGTCCGCCGGCTCGGCTCCGCCCCCGGAGAGCTCAGGCCAGGTGCCGGGGCTGGACTGGCACAGGGATGCTGACGATGGACTCGCACACGGGGACCGGGCGGTAATGAGGCGCTGCCGTGTGCCGCGGCCCGCCGGCTCCATGTTGCATTCGTGGGGTTTCAGCGCCATCCGCCAGCCTTCCTAGCTCACTCCACTTTATGACTCCACTAAGTAGCAGCAGGAGGCGGGGCCTGTGTGCACACGCGCAGTGTGACTCTGCGTCCTCACGCACGTGCGACTGCTGTCTGCTCTAACTGGGCTGCTCTTGTTTCTACTCATCCTATTTAATGACGTTAATGTTTCCTGTCTAATTTCAAAATAAACATGGGGATGGCT