Transcript asmbl_31637

Sequence
Transcript Sequence for observation asmbl_31637 of TGE0004615:
CCCGGGGCGGGGGCGGCGGCGGGAGCCGAGGTCGGGGTCGGGATTAGTGTCCGCGTCTGGATCCGGCCCGGGCCGCCGGCACTCCTGGGCGTCCGCTTCCGGGCATGGCGGCCGAGGTGCGCGTTTCGCGCTGGTACTTCGGGGGCCTGGCCTCGTGTGGGGCAGCCTGCTGCACGCACCCGCTGGACCTGCTCAAGGTGCACCTGCAGACGCAGCAGGAGGTGAAGCTGCGCATGACCGGCATGGCGCTGCAGGTGGTGCGCTCCGACGGCATCCTGGCGCTCTACAACGGCCTGAGCGCCTCCCTGTGCAGACAGATGACCTACTCCCTGACCCGATTCGCCATCTACGAGACCGTGCGTGACCAGGTGGCCCAGGGCAGCCAGGGGCCCCTGCCCTTCTACAAGAAGGTGTTGCTGGGTTCCCTCAGTGGTTGCATCGGAGGTCTCGTGGGGACTCCCGCTGACATGGTCAACGTCAGGATGCAGAACGACATGAAGCTGCCCCAGGATCAGCGCCGAAACTACGCGCACGCCCTGGACGGCCTGTACCGTGTGGCCCGAGAAGAGGGTCTGAAGAAGCTGTTCTCGGGTGCGACCATGGCGTCTAGTCGAGGGATGTTGGTGACCGTGGGCCAGCTGTCCTGCTATGACCAGGCCAAGCAGCTCGTCCTCAGCATGGGGTACCTGTCTGACGGCATCGTCACTCACTTCATCGCCAGCTTCATCGCAGGTGGGTGTGCCACGTTTCTGTGCCAGCCGCTGGACGTGCTGAAGACCCGTCTGATGAACTCCAAGGGCGAGTATCAGGGCGTTCTCCACTGCACCATGGAGACTGCGAAACTCGGGCCAATGGCCTTTTACAAGGGCCTCTTGCCCGCCGGCATCCGCCTCATGCCCCACACCGTGCTCACGTTCGTGTTTCTGGAACAGCTTCGCAAACACTTTGGCATCAAAGTGCCGTCCTGATGGGGCCGTGGGAGCGAGCTGGGCCGTGCTGGCCCCCAGTGCCAGTTCTTCCACAGTCCCGGCAAGCCAAGCGCTGCCCTAAGCCCAGCACCTGCCCGCAGGGCTCCAGCCCCCCATTCCTGGCCCAGGACGCCCACCCCGTCCTCCCCCACCTGCCTGGGCTGGAGCTCCTTCCAGGAGCTGTCCCCCCAGCACCCCTCCGCTGTAGCTTCGCCTTGGCCCTCCCTACCTGGCACCCCAGTGGCCCCATCCACGCACCTGTGCCTCACTGGGAGGGGCGGGCTCCAAGTGCAGGTTCAGGCTTCTCCCCTCCCCGAGCAGTCAGCCCTGGCGGGGGAGGGGCAGGCTCCAGGCTTTCTGGGGTCCCCCGCCCCTTCGCCTGAGGCGTTTCTTTCACCGAGCAGCTGCCCAGGGCTCACAGCACCGTCTTCCAGCAGCTTCTTTCAAGGACCTGGGAGGCAGAGCGGGGGGAGTGCAGACCCCCAGCATTGCCCACCAAAGCGTGTGCCTGCACGCGCACTTTATCCTAGGAAAGGGACCATAGCTTTCGTGACGTTCTCGAAGGTAGCTGTGCCCCTGCGCTGCTGGGCAGGTGGCGGAGGAGGCAGGGAACGCAGGGTCTGAGCTGTGGGCCCCTCAGGCCCGTCCCGCCCCAGCCAACCCCCTGTTGCTCTAAGGGTTAGTTTCACCAAAAACCTCAGCGCCAGAGGCGCTGCTGTCTGCAGGGAGCGGAGTGTCTCTCACACCGTCCACGCTGTCCCCTCCGGCCCCCGGGGCAGAGGCGGGCTGTGCCGCGTCCTCGGGGCCCCTCTCTCTGTGGACAGCGATCACCCTTCAGGGCCCCCAGCAGCTGACCAGCCAAAACACCGCCGCCCAGGTTCTGCTGCCAGAGCAGCCTGACCCTGCAAATGGGCCTAGGGACTGTGTCTTCACCCCGGTAGGGGGCCGGCCCACAGGGACACTAATAAAGGACAGGAGCTGCTGTGCGTCTAGTCCTTGCATCCAGTCCCTGCGTCCAGGCTGCTCACTGCTCTGCAGGCCGCCTTGGTGCCTGGGGGCAGCAAGACCCCCCTCTGCACCCCACAATGAGGGCTCTCTGGTTTATGGGGGGCAGGGCCCAGAGGAGGAAGAAGCGACAGCCCTGCCTGGATACACAGGGTAGCCTGTGGCAGAGGGAGGGGTCTG