Transcript asmbl_16497

Sequence
Transcript Sequence for observation asmbl_16497 of TGE0003870:
GTGGTAGGGAACTTGGTGGGGGGGAGGCGGCAACATTGTTTCAAGTTGGACAAATTGACAAGAGCGAGAGATACACTGAGTTCCATCCGGACCTGGAGACGCGGTTCTGGGCCCTGTTTTCCCCTCCTCCGCCCCCGAGAGCCGGGGCCCGCTTTTTGCAGGGTTCCCAGGCCCCCGCTCCAGGGCCGGGCTGACCCGACTCACTAGCGCTTCATGGAGAACTTTCAAAAAGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAAGCCAAAAACAAGCTGACTGGAGAAGTGGTGGCGCTTAAAAAAATCCGCCTGGACACTGAGACAGAGGGTGTACCCAGTACTGCCATACGAGAGATCTCTCTACTTAAGGAACTTAACCACCCTAATATTGTCAAGTTGCTGGATGTCATCCACACAGAAAACAAACTCTACTTGGTTTTTGAGTTTCTGCACCAGGATCTCAAGAAATTTATGGATGCCTCTGCTCTTACTGGTATCCCTCTTCCCCTCATCAAGGTAATCTTTCTCATCAACTCTTCCCCAACATGGGCATGTCTTGGGGGAACCGAAGGCAGGCAATTCAGACTGAATGATGATTTGTGACCTTGGTTTCCTTCTCAG