Transcript asmbl_30538

Sequence
Transcript Sequence for observation asmbl_30538 of TGE0002528:
GAGCAGATGGATCTGCAAAGGAGGTGATTGGTTTTTAAAAGTGGCACCAAGCATCTTGCTGTGTTTTTTCTTTAGTTTTTTAACTAGTGACTGGAAAGAGGGAGGGTTTCCAAGAATAAACCAAGTTGGATTACCTAGCGACTCCAGACACGTAAGAGGTCTAAAGAAAAAATTCACGGCAGTTTACTTTTCTGATTTTGAACCAAACATTTGGCCATTTTTAAAGAAATGCTGAATACGGTATAAATGGGATTTGAATTAGAAAAAAATTTGTCTATTTTCTGCCCTGTAAAGCTGTCTCGGATACCAACGTCCTCAGTAAGGTTTTCTAGACCCACTTGGTTAGGACACTGATATATTTTCAGGCACATAGCAGTAATGACGAATAGGAGCTTAACTCTGCTTATGTATGGATTTGTATACATGTTTGATAACGGGTTACATAGGTGGGGATTGAAATCCAAACTAAACGTGTTTAGTTACCTTTTTTGTATCATGCAAACTTCCTTTTAACTGTCATGCATTTTTCTAGTAATAGCTCTTCAAGTCTGCAATAAAAAATGGCCTCCAATAAAACCACATTGCAAAAAATGGGAAAGAAGCAAAATGGAAAAAGTAAAAAAGTCGAAGAGGCAGAGCCTGAAGAATTTGTGGTGGAAAAAGTACTGGACCGACGCGTCGTGAATGGGAAGGTGGAATATTTCCTGAAGTGGAAGGGGTTCACAGATGCTGACAATACTTGGGAACCTGAAGAAAATTTAGATTGTCCAGAGTTAATTGAAGCATTTCTAAATTCTCAAAAAGCTGGTAAAGAAAAAGATGGTACAAAAAGAAAATCTTTATCCGACAGTGAGTCTGATGATAGCAAATCAAAGAAGAAAAGAGATGCTGCTGACAAACCAAGAGGCTTTGCCAGAGGTCTTGATCCTGAACGAATAATTGGTGCCACAGACAGCAGTGGAGAATTAATGTTCCTCATGAAGTGGAAAGATTCAGATGAGGCAGATTTGGTGCTGGCAAAAGAGGCAAATATGAAGTGTCCTCAAATTGTAATTGCTTTTTATGAAGAGAGACTAACTTGGCATTCTTGTCCGGAAGACGAAGCCCAATAATTGTTTGCATTGCTTTTTATATATATTTATATATTAGTGTGAAGAAATAACTACATTCTAATGAAAATCAAGTTTGACATGTTTGTTTTGAAGTAGTATTGGGGGAGTTGTTGGGGGGTGGTTTTGCATCTATAACACTGGTTACTTTGAACAAAAGCTTTCTGTAGTTGCTTTCTTTATCAGAAAAGAATATTTGATACCATGGTATACTTTTTCCTCTGCATTAGAAAAGTCTTTCTAAATGTTAGGGGAAATCTCCATTGTCATTACTCAGTCAGAATTTGAGTTTAACTCACGTATGCCTAGGAGGGATCATCCTGGGTTTTATTTTATTTGGGGATTTTTGGTGTGTATACATACAACATATGTAAACGGTTTTCTTTTT