Transcript asmbl_29872

Sequence
Transcript Sequence for observation asmbl_29872 of TGE0027129:
CCGGAGTAGGGTGGGGGTTGGCAGGGGACTGGGCTGGGAACGGGCGGTCCCTGACCCCCGCCCTTTGACCTTTCTCCTGCAGGCGACCATGGGGAACGTATTGGCAGCTAGCTCGCCGCCCGCAGGGCCGCCGCCTGCGCCCGCCCTCGTGGGACTGCCGCCGCCGCCACCGTCTCCTCCGGGTTTCACGCTGCCGCCACTCGGGGGCGGCCTGGGCGCTGGGGCTGGGGCGGGTCGAGGTTCGGAACGGACGCCCGGGACTGCGGCCGCCAGCACCGCAGGAACCGCGGACGATGGGGCCAGCGGCTGCCTTCCCAACCCGGGCACGTTCGAGGAGTGCCACCGGAAGTGCAAGGAGCTGTTTCCTATTCAGATGGAAGGTGTCAAGCTCACAGTCAACAAAGGGTTGAGTAACCATTTCCAGGTGAACCACACAGTAGCCCTCAGCACAATCGGGGAGTCCAACTACCACTTCGGGGTCACGTATGTGGGGACGAAGCAGCTGAGTCCCACCGAGGCATTCCCCGTGCTGGTGGGTGACATGGACAATAGCGGCAGCCTCAATGCTCAGGTCATTCATCAGCTGGGCCCCGGTCTCAGGTCCAAGATGGCCATCCAGACCCAGCAATCAAAGTTTGTGAACTGGCAAGTGGACGGGGAGTACCGGGGTTCTGACTTCACAGCGGCTGTCACCCTGGGGAACCCAGACGTCCTGGTGGGTTCAGGAATCCTCGTGGCCCACTACCTCCAGAGTATCACACCGTGTCTAGCCCTGGGCGGAGAGCTGGTCTACCACCGGCGGCCCGGGGAAGAGGGCACTGTCATGTCTCTAGCAGGGAAATACACATTAAACAACTGGTTGGCAACAGTAACATTGGGCCAGGCGGGCATGCATGCAACTTACTACCACAAAGCCAGTAACCAGCTGCAGGTGGGCGTGGAGTTTGAGGCCAGCACAAGGATGCAGGACACAAGTGTCTCCTTCGGTTACCAGCTGGACCTGCCCAAGGCCAACCTCCTCTTCAAAGGCTCTGTGGACAGCAACTGGATCGTGGGCGCCACACTGGAGAAGAAGCTCCCACCCCTGCCCCTGACGCTGGCCCTCGGGGCCTTCCTGAATCACCGGAAGAACAAGTTCCAGTGCGGCTTTGGCCTCACCATCGGCTGAGCCCCTCTTGGTCCCGCCTCCCACGCCCTTCCTTCAGATCCCACCCCCCTCCCCTGTCACAGAGGGGAGACCTGAGCCCCCTCCCCGTCTCTTCCCTCCCTCCCAGGGGTTGGGGGAGGGGGGAGCGGAAAGGAGGGGACCCATCGCCCCAGCAGCTGAGAGGGGATTCTGGAACCACGGGCACTTCAGGATTCGGAGCGCCAGGGGCAGC