Transcript asmbl_28859

Sequence
Transcript Sequence for observation asmbl_28859 of TGE0004512:
GGGCCGGGGGAGGGGCTGCGTCCGCCGGGCCTCCTACCAGGCTATCCTAGCGGTGCCGGGCGGGTCAGAGAGCGCAGCGCGGCGGCAGCAGGAGCCGAGTAGCGTGCAGAGCCGGTCATGGGCAAGTCAGCTTCCAAGCAGTTTAACAGTGAGGTCCTGAAGGCCCACAACGAGTACCGGCAGCAGCATGGCGTTCCTCCACTGAAGCTCTGCAAGAAGCTCAACCAGGAGGCCCAGCAGTATTCGGAGGCCCTGGCCAGCACGAGGATCCTCAAGCACAGCCCAGAGTCCAGTCGTGGCCAGTGCGGAGAGAACCTAGCTTGGGCATCCTACGATCAGACAGGAAAGGAGGTGGCTGATAGATGGTACAGTGAAATCAAGAACTACAACTTCCAGCAGCCTGGCTTCAACTCTGGGACTGGACACTTCACGGCCATGGTGTGGAAGAACACAAAGAAGATGGGAGTGGGGAAGGCATCTGCAAGTGATGGGTCCTCCTTTGTGGTGGCCAGATACTTCCCAGCAGGGAATGTTGTTAACCAGGGCTTCTTTGAAGAAAATGTGCTGCCTCCAAAGAAATAACTTGTCAAACATAATGGGAAGGTGGCAGACTTAAGAACGTGGTATGAAGTACCTAGAAGAACATTAGCTGTGTGTTTGTCCTTGTGGGTGTACATGCTTGTGTGTGATGCATGTGTGCATCTCTTGCACACATACTCGGATATACAGTTCTGTATGAACTCATTCTTGTCAAAAGAATGAGCATATGAAGGCTTTACTCTGATAGTTACCTAGACCACAATTATTTGGACTTTGGGGGCAAAATCAATTTTTAAACTTTTTTTTTCATTTTTTTAAGCAAACTACTTTTGTACGTTTCTTACTTTTAATATCCATCCCTGGACTTTTTATATTCCTCATGTTTGTGATACTGAGAACTGAAGTTCATTTTTTGTGATCTTCATACATTGTAATCTACTTGTGGTAGATATTTAAAAATATTAAACCTTCATTTAAATGTGACATAAAATGCAGCTTTAAACACATAAATATAAAGCAGCTTCCATGAGAAAACTGGTGTAGGCAGGAGTTCCATCTCACAGAATTACTGAGATTTCTCAGTTGTAAGACATGATGTCATCTGCATGCCTCCTGGAATTCTCTAATGGGATTGCCAAAGAACAAATGGAGAAGAAAACTTTACTTCTTTGCATTTTTCTACCTTTAAATAGCAAAGTACCACTACCACAACTACCCCTTGCCCCCTCCCCCATCTTTTTTCTTAAAATTCTCTGGCATTTCAGGGCTCAATATGTTTCCTGATTTCTGGAGAACTGGGCAAGGCCTGAAATTCACCCCTCCCCCACCTCTGCTGGGCGGCCCAGGACCCGTTCTGGGAGAGAGCCCCTCATACTGCCTGGGCTCTCAGCCAAGCGGCCTTGGATGGATGAAGTCAGTGAGTGTGGGGGAGAGGGTGAGCTCACTCAGGGCCCCCAGAGGAAGCTCTCCAGCCTCTGCCCTCCCCCTGACACACAGGGCGGGAGCCCGGGCTATTCGTGGCAGCTGTGGCTGCAGCTGTGCTGCTGTACCCTCCCAGAATGTGTGACAGGCCCAAATGTTCCTGGGAGATATCCCATGCGGGGCTTAGAGTCGCTAATTTGGTTCTGTGTTTTGCCTCAAACTGCACAAAGCTCCCCTAAACAACAATTTCGTATGGTGGGGGAGGGACCAATCCAGAGGCCAAGCTGAGTGTCCCTGAAACCATGGCATCTCCAGGTGGTAAGATAGCAGGAGCAGGAGTTAGGGAGTTACCTGCTTAAAGACTGGAGTCTGAGCAGGCCAGTCTGATACATGCTTCCCGAAGGTCTGTGTTGCACTGTGAACACAGTCTCATGCTGTGCCCTTCATTTCACCCAGAGATATTGACTAAGACAACAATAAAAT