Transcript asmbl_28559

Sequence
Transcript Sequence for observation asmbl_28559 of TGE0004497:
GGGGTTCAGGATTCGGTGTCGGGATAGGTCCTCCCTCGTGCGGATCGCGAGGCCGGTGGGCTTCTGCTTTCCCTGTCCCCACTGCCCGGCTCGGAGGAGGCACCTCCGCCCCCTTGAGAGAAACGGTCCACTCTGAAGAATCTACACTCGCCGTTATCTGTAGTCATCTCGTAATTGTCGAAGGCCCGCGCGGAAACTTGGCCTGAGCCTACTACGGCTTTGTGACTTGTGTCAGGTTAGCCAGAGGGCTAAATGGAAACAGGAGAAAGTGCTTCTGCGTATCCCTTGAGAATGGTGGTGGGACTGCCAGGAACGGCTTTTCACTTCAGTAGGCGTCTGAAAGGGAAATCGTAGTAACTTAAATAAAGGGGTTCAGGGCTTTGAGAAGTTATGCTTAGAAAGACCCGTGTTTTTTAGCCACAAACACCTAGACGCTAAATAGTAATATCTTCGTAATGGAAATTTCCAGGGATGTGCACAGATAGTCATAGATTTCTGAAGTAGTTAATAAGATGCATTTAAACAAGCTGTCCGTTGAAGGGCTTGTCAATGTTTTTAGCGGTATTCAGATCTCTAGCCAAAACGTTTGACACATGCAGGGAAGGTCCACAGCAGATGCACTAGAAACCAACTTCTTCATTTTTTACCCCACTACTAGGTAAGGGACCTGGAAACCAAGAAGTGACTGCTCATCTAATCCGCTAAAGCTATGTTAGCAGATTGGAGCTGTTTGCAGACAAAGTTCCAAAGACAGCAGAAAACTTTCGTGCTCTGAGTACTGGGGAGAAAGGATTTGGTTATAAAGGTTCCTGCTTTCACAGAATTATTCCAGGATTTATGTGCCAGGGTGGTGACTTCACACGCCATAATGGCACAGGTGGCAAGTCCATCTATGGGGAGAAATTTGATGATGAGAATTTCATCCTGAAGCATACAGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAATACAAACGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAATGGTTGGATGGCAAGCATGTGGTCTTCGGCAAGGTGAAAGAGGGCATGAATATTGTGGAGGCCATGGAGCGTTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCTAATAAATTTGACTTGTTTTATCTTAACCACCAGACCATTCCTTCTGTAGCTTGCGAGAGCACCCCTCATCCCGCCTGCTCGGAACACCCTGTTATAATCGGCTCTCGCTGCGGTTCTTTGGGTTCCGGGTTTTCCTTGTACCTCCACGTCTAGCTGGGTTGCAGAGTTAAGTTTATGATTATGAAATAAAAGTTAAACAACA