Transcript asmbl_28263

Sequence
Transcript Sequence for observation asmbl_28263 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTA