Transcript asmbl_26962

Sequence
Transcript Sequence for observation asmbl_26962 of TGE0004430:
GTTCGTTCACCTTAGTCCGACTCTTCGTCGTGAGAGAAGCTGGCCAAGGGGGCCGGGGCTTGCACTACACTTCCCGGGAGGCTGTGCGCAGCGGCGCGTCCCGTAACGGGAGCGCGGGCTTTGGAAGGCAGCGGAGCGAGAGGTGATCTGCGGCTGAGCTGAAGCGGTAGCGGGGCTGAGGACTGTCCTGGGCGACACCGGACCAAGCGCTAGCTGCCGAGGCCTCGTGCCCCTAGGCCAGCCGTTCCTCCTCCGTGTCGCTATGGGTATTCAAGGCCTGGCCAAACTGATTGCTGATGTGGCCCCCAGTGCCATCCGGGAGAATGACATCAAGAGCTACTTCGGCCGCAAGGTGGCCATCGATGCCTCCATGAGCATTTATCAGTTCCTGATTGCCGTTCGCCAGGGTGGGGATGTGCTGCAGAATGAGGAGGGTGAGACCACCAGCCACCTGATGGGCATGTTCTACCGCACCATCCGCATGATGGAGAACGGCATCAAGCCCGTGTATGTCTTCGATGGCAAGCCGCCACAGCTCAAATCGGGTGAGCTGGCCAAACGCAGCGAGCGGCGGGCTGAGGCCGAGAAGCGGCTACAGCAGGCTCAGGATGTTGGGACTGAGGAGGACGTGGAGAAGTTTACTAAGCGACTAGTGAAGGTCACCAAGCAACACAATGATGAGTGCAAGCATCTACTGAGCCTCATGGGCATCCCGTACCTCGATGCGCCCAGCGAGGCAGAGGCCAGCTGTGCAGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCCACGGAGGACATGGATTGCCTGACCTTTGGCAGCCCTGTGCTAATGCGGCACCTGACTGCCAGCGAGGCCAAGAAGCTACCCATCCAGGAATTCCACCTGAGCCGGATTCTTCAGGAGCTGGGCCTGAACCAGGAGCAGTTTGTGGACCTCTGCATCCTGCTGGGCAGCGACTACTGTGAGAGCATTCGAGGCATTGGGCCCAAGCGGGCTGTGGACCTCATCCAGAAGCACAAGAGCATCGAGGAGATCGTGCGTCGACTTGACCCCAGCAAGTACCCCGTGCCGGAAAACTGGCTCCACAAAGAGGCCCAGCAGCTCTTCCTAGAGCCTGAGGTGCTGGACCCAGAGTCTGTGGAGCTGAAGTGGAGTGAACCAAACGAAGAAGAGCTCGTCAGGTTCATGTGCGGCGAAAAGCAGTTCTCCGAGGAGCGAATCCGCAGTGGGGTCCGGCGGCTGAGCAAGAGCCGCCAGGGCAGCACGCAGGGCCGCCTGGATGATTTCTTCAAGGTGACCGGCTCGCTCTCGTCAGCGAAGCGCAAGGAGCCCGAACCCAAGGGATCCGTGAAGAAGAAGGCGAAGACTGGGGCGGCAGCAGGGAAGTTTAAGAGGGGAAAATAAACAAGTTCCCCTTCAGTACACCTCCGTGCCCAGAGTTATCTGCCCCGTCCCCTTGAGGGCTGGCACTGGAGAAGCCTCCCCTGGGGCAGGGAGGGGACTGCGTTGCTTCTGTGGCATGCGCCTTCTCAGTACTGCAGTTCCCTTTTTTACTTGATCTTATGGCAGGAAAGCCGCAGAGGTACTTTGTTTTCTTCTTTTTTTAGCTCAGGAAAGTATGTCAGCCTCAAACTACCTTTCACTTTAATGGACACTGAATTCATTGTTACGTAAAAGTGATAGCAACAGGTTTTGAAGAAGGGAGAGGGAGAGAAATGGTGGAGACAAAAGACTTTACAGAAGTGATTTCCTGGCTGGCCAGCCGGTGGCCGGTGATGGCGGAACCAGACCACGCTTCTCTGGTTCAGCCTTGACCCACCATGAAGGAAGGACAGCCGGCAGGAAGACCCGGTCTTAGCAAATAGGAAGAGCTACTAAGAAATAAGACAGGCAGAGAGCTGGAGTACATGGACTTGGCAACAAGGGTTCGATTACTGGCTGTGTGTCCTGGGGTGGGCAGAAACTTGAACTTGCTGTGTAACTTGAGTCTTTAGTCATTATTTAGAGGCATAAGGTGGTGAAGTTCTTCTCATGGCCTTTCTGAGGCAATCAACTGAGTCGAGACTTTGGGAAAAGATGCTGTTATGTTTTTGTTTTAAGGTTATGAGAAAAGAGTCAATAAAATTATAAAAGTAA