Transcript asmbl_26893

Sequence
Transcript Sequence for observation asmbl_26893 of TGE0004418:
CCTGGCTGCTGTGGCCTCCCCTGACCCCCTCCCCCCGCTGCTGGGGTCCTCGGGCAAGCCCCCTTCTCACTGGACTGAGACATGAGGCTGAACTGGGTCCTGACAATACTGTCCATCTGCCTGAGCGCCCTGGCCACGGCCGCAGGGGCCGAGGGCAAACGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTAGACCACTGTCCCATCAAATCGCGCAAGGGGGACGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAATTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTGGGCACGGGCCAGGTCATCAAGGGTTGGGACCAGGGGCTGCTGGGGATGTGTGAAGGGGAAAAGCGGAAGCTGGTGATTCCATCAGAGTTGGGATATGGAGAGCGGGGAGCCCCGCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAACTGCTCAAAATCGAGCGACGTTCAGAACTGTAGCAAAGCTGGGGAGGGGCAGCGGAGAGGCCATCAGGGACCAGACTGTTTAAAAGAAAAACAAAAACA