Transcript asmbl_26876

Sequence
Transcript Sequence for observation asmbl_26876 of TGE0004413:
TGCAGCTTAGTGCTCCAGCCCCCGCCTCCTGCAGCAGCCCGGTGGGGGGTGGGGAGGCGGGACCGGGTGGCGAGGTTGTGGTCTCAGGGCCGGGCGTGGAGCTGACATTATGTACGTCCTGGCCCACTGTGCCAGCTCGGTACCTGTCCGGGCAGTTGCCATCCATTGTGCGACAGCGGCGGCAGCCAGAGCGTACCTGGAAGGAGGTCTACAGTGGACGCTTGGCAAGGCCCGCGGTTTCAGAAGCGCCGCTGCAGCTATGGCCCCGATCAAGGTGGGAGATACCATCCCGTCTGTGGTGGTGTTCGAAGGGAAGCCTGAGAACAAAGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAGGGGGTGCTTTTTGGAGTCCCTGGGGCCTTTACCCCCGGTTGTTCCAAGACCCACCTGCCAGGGTTTGTGAATCAGTCTGGGGCTCTGAAGGCCAAGGGGGTCCAGGTGGTGGCATGTCTGAGTGTTAACGATGTCTTCGTGACTGAAGAGTGGGGACGAGCCCATAATGCAGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACGGATTTGTTGCTAGATGATTCATTGGTGCCCCTCTTTGGGAATCGACGGCTCAAGAGGTTCTCCATGGTGATCGAAGATGGTGTAGTGAAGGCTCTGAACGTGGAGCCGGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCGCAGCTCTGAGGCCCTGGGCCCAGATACACTCCTACCCTTTTTTGTTTCACCTGCCCAGCTAAAGGCAGAGGGCCCCAGCCCAGCCTCAGCTAGGGCCACCCGATTGGAACTTTGGCTAGATTTCTTCAATAAACACTTTTGGTTCA