Transcript asmbl_26603

Sequence
Transcript Sequence for observation asmbl_26603 of TGE0004379:
TGCGCGCGAGAATTGTCCGGCCGGCATCCGGGACATGAAGGTCCCTAGAACTGAACTCAGAGAGGTCAGGGGACAGCAGTTGGTGGCACAACTGGAGCTCCAGCGGTCTGTGGCTTTCCTGTTTCCATCGCCCCGTCTTAGCGTAGGGGCCACACACCCCTCTGTCCCGCTTTGTCTTCCACGAGGGGGATGACGACAGGACTGGCCCAGGTCGTGGAGAACTCCGCCTGACGTGGTCGATAAAGGTCACCCAGGGCTGCGGCCCTGCCCCGAGGCCACCTTCGTCTCCACGGGCCATGCAGGAATTCAGTTGGTGAGAACTCGGATAGGTGACCGGTACACTCGCCATTCTGTTGAGGACCAAGTCGGCTCGGGGGCCAGACTGGTGTCAGAGACGGACACTCGGGGCACGTCAGTCGGCATTTCTCAAATTGCACGTCACTGAGTAGCGAGACCGATTTGACTGGTAGAAACCAGTGTCTTGAAAATGAAGGAGAAATGATCAACATGTGTCACATCAGGAGAGACCTGGTCAACTGCTGTCACTGCACACATGGCACGTGTGCACACACGAAGCGCACACGTGTACTGGGCTGTGGTACACTTCCTTACTGTGGATCTTGATGGAAAACACTGGAAAGTCACCGCTGTTCACTGCACTTTGGTCACACCACTGAAACGATCCTCCCCAGAGCTGGGACCCTCGAATGGTGCAAGCAGCAGGGTGCAAGCAGCAGGGTGCAAGCTCTGGGTGCAAGCAGCAGGTCCAGAGCCCTCTGGGCAACCAAAGGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATACAGACTCTTTTTTTG