Transcript asmbl_26546

Sequence
Transcript Sequence for observation asmbl_26546 of TGE0004373:
GCCGTTTCCGTTAGGTACAGGAGGCTGAGGCGCGCGACCCGCCGCAGTCCCACGTGAAGGGCTACGCGAGCATCGCTCGGCGGGACAGCTCCCCGCTCGCCGCGGAGCGTCCCGGAAGCAGCGGGGAACCGGAAGTGGCCCGCGGCAGCTCAGAAGCTGATCCCGGTTCCCGGTGTGTGGCCCCTCGAAGCGCAGCGACGGCGCCATGTCCCTGATCTGCTCGATCTCCAATGAAGTGCCAGAGCACCCGTGTGTGTCCCCTGTCTCTAATCATGTCTATGAGCGGCGGCTCATTGAAAAGTATATTGCAGAGAATGGCACAGACCCCATCAACAACCAGCCTCTGTCCGAAGAGCAGCTCATCGACATCAAAGTTGCTCACCCAATCCGGCCCAAGCCTCCCTCAGCCACCAGCATCCCGGCCATTCTGAAAGCCTTACAGGACGAGTGGGATGCAGTTATGCTGCACAGCTTCACTCTGCGCCAGCAGCTGCAGACAACCCGCCAAGAGCTGTCCCACGCGCTGTACCAGCACGACGCCGCCTGCCGTGTCATTGCCCGTCTCACCAAGGAAGTCACTGCTGCCAGAGAAGCTCTGGCTACCCTGAAACCGCAGGCTGGTCTCATCGTGCCCCAGGCTGTGCCGAGTTCACAGCCAAGTGTTGTGGGTGCAGGCGAGCCCATGGATTTGGGTGAACTGGTGGGAATGACTCCCGAGATCATACAGAAGCTCCAAGATAAGGCCACTGTGCTGACCACGGAGCGTAAGAAGAGAGGGAAGACTGTGCCTGAGGAGCTGGTGAAGCCAGAAGAGCTTAGCAAATACCGTCAGGTGGCATCGCACGTGGGCTTGCACAGTGCCAGCATTCCCGGGATCCTCGCCCTGGACCTCTGCCCCTCCGACACCAACAAGATCCTCACTGGTGGGGCGGATAAAAACGTCGTCGTCTTTGACAAGAGTTCTGAGCAGATCCTGGCCACCCTCAAGGGCCACACCAAGAAAGTCACCAGTGTGGTGTTTCACCCTTCCCAGGAGCTGGTGTTTTCTGCCTCCCCAGATGCCACTATCAGGATTTGGTCTGTCCCGAACGCCTCTTGTGTACAGGTTGTTCGGGCCCATGAGAGCTCTGTGACCGGCCTCAGCCTCCACGCCACTGGCGACTATCTCCTGAGCTCCTCTGATGACCAGTACTGGGCCTTCTCTGACATCCAGACAGGGCGTGTACTCACCAAGGTGACAGATGAGACCTCTGGCTGCTCTCTCACCTGTGCGCAGTTCCATCCCGATGGGCTCATTTTTGGAACGGGAACCATGGACTCTCAGATCAAGATCTGGGACTTAAAGGAGCGCACCAACGTGGCCAACTTCCCTGGCCACTCGGGCCCCATCACCAGCATTGCCTTCTCCGAGAATGGCTACTACCTGGCCACCGCGGCCGACGACTCCTCTGTCAAGCTCTGGGATCTGCGCAAGCTTAAGAACTTTAAGACACTGCAGCTGGACAACAACTTTGAGGTGAAGTCGCTGATCTTTGACCAGAGCGGTACCTACCTGGCCCTTGGGGGCACAGATGTCCAGATCTACATCTGCAAACAGTGGACGGAGATTCTTCACTTCACAGAGCACAGCGGCCTGACCACAGGGGTGGCCTTTGGGCACCACGCCAAGTTCATCGCTTCCACGGGCATGGATAGGAGCCTCAAGTTCTACAGCCTGTAGGCCCTGTCCCCTCTGACGCAAGCTGAACCTCATCTCAGTAGTGGGGTAGAGTTAGGGTTG