Transcript asmbl_26160

Sequence
Transcript Sequence for observation asmbl_26160 of TGE0000661:
CGCTTCCCATAACTCCGTGTGCTCGCCCCTCCCGTCCTCTTTCCGCCATCTTTCCGTGCCGCCATAATGGTGCGCATGAACGTCCTGGCCGACGCACTCAAGAGCATCAACAATGCTGAAAAGAGAGGCAAACGCCAGGTTCTCATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTGACTGTGATGATGAAGCATGGTTACATTGGCGAATTTGAAATCATCGATGATCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGTTAAACAAGTGTGGAGTGATCAGCCCCAGATTCGACGTGCAACTCAAAGATCTAGAAAAATGGCAGAACAACTTGCTCCCGTCCCGTCAGTTTGGTTTCATTGTACTGACAACTTCAGCGGGCATCATGGACCATGAAGAAGCAAGACGAAAACACACAGGAGGGAAAATCCTGGGATTCTTTTTCTAGGGATGTAATACATTTGTTCAAATAAAATGCCTCAATGGAC