Transcript asmbl_25925

Sequence
Transcript Sequence for observation asmbl_25925 of TGE0026960:
CGAGCCGCATCTCCCTCAGTCGCCGCCGCTGGGGCCGCCACCGCCCGTCCTCGTCGCCCGAGCCCGGACACCATGCCACAGGAAGAGTGACCTCGTCCCTGTTTTCACGATGGAGGACTCGGGAAAGACATTCAGCTCTGAGGAGGAAGAAGCTAACTATTGGAAAGATCTGGCTATGACCTACAAGCAAAAGGCAGAGAATACACAAGAGGAGCTCCGAGAATTCCAGGAGGGAAGCCGAGAATATGAAGCTGAATTGGAGACGCAGCTGCAACAAATTGAGACCAGGAACAGGGACCTCCTGTCAGAAAATAACCGCCTTCGCATGGAGCTAGAAACCATCAAGGAGAAGTTTGAGACACAGCATTCTGAAGGCTACCGTCAGATCTCTGCCTTGGAGGGCGACCTCGCCCAGACCAAAGCCATCAAGGACCAGCTGCAGAAGTACATCCGTGAGCTGGAGCAAGCCAATGACGACCTGGAAAGAGCGAAACGGGCTACGATCATGTCTCTGGAAGATTTTGAGCAGCGTTTGAATCAAGCCATTGAAAGAAACGCCTTCCTGGAGAGCGAACTTGACGAGAAGGAGAATCTCCTAGAGTCTGTCCAGCGGCTGAAGGATGAAGCCAGAGATTTGCGGCAGGAATTGGCTGTGCAGCAGAAGCAGGAGAAACCCAGGACCCCCCTGCCCAACCCGGTGGAAGCCAGCAGGATAGACACTGCTGTGCAGGCCACTGGCTCCGTGCCATCTACCCCTGTGGCCCCCCGGGGACCCAGCTCCAGCTCAGCCACACCGGGGACGTTCAGACGCGGTCTGGAGGACTCCATGGGCGGGACTCCCCTCACACCCGCGGCCCGGATATCAGCGCTCAGCATCGTGGGAGACCTGCTGCGGAAAGTGGGGGCACTGGAGTCCAAACTTGCATCCTGCCGGAACTTCGTGTATGAGCAGTCCCCAAACCGAACAAGCGGCCCGGCCTCAGGACGGGGGAGCAAGAGCAGAGATGGCGGCGACAGACGGCCAGGCAGCACCAGCGCACCTCTGGCTGATAAAGGGTCGGGAAAACGCCTGGAATTTGGGAAGCCGCCTTCCAATCTGTCCTCGCCATCGCTGCCGTCAGCCCAGGGTGTAGTCAAGATGTTGCTTTAGAAAATCCACAGAAGCGAAGCTGCCGATGTCTGTGCGGGAGTTGTCACCTGTTCCCCTCTTTACACTAGGTTTTTATTTTTCTTTCTTTTTTTTTAAGTTAGTCTGAGAAATACGAGTGAACAGTCATACTAGCCATTGACTGAGGCTGATGCCTGTGGTCCCCGTGAACTGTTGTCTCGTGAACCCCAGCCTCCTTGTCAGTGTGTTGCAAACGGACCCCCCTGGAAGAGGGTGCTCAGGTGTGCTGCTGAGGCGACCCTGTCATTTCGAGCTGACCCGGGTCCTGCTTGGTCTCGAGAGGTGGTTTGAATGTCCACAGACGCCTCACGAATGGGATGTGAGCCACGTCGAGCCCACCCCGGCCCCACTTGGCACAGGATGGCACAGCAGGGTCAGCACGCTGAGAGCATGTCTAGGGGCGAAGGGTGGCCTGGGCACAAGCCTGTTTTTAAAACTGTGGTGTAGTGTACCTCCCACGCTTTTTATTCTGCCTCTCACGGAGGCTTTTAGAGGTGTGCTCAAGTTTTAGAGTAAATTTTGTGTGGACCAGGTCAGTGGAAAATCTGTGTCTTCTTTAGATCTGTCCCAACCGTTAATTGTCCTCGGTCCCCACCCCTCGCGTGGTGGGGGGGAGGACCTCCGCTTCAAGACCCTGAGGGTCACTGGGATGGAGTGGCCTCTTAATATGCAGCTTTTAAGAATAGGACTTTATTCAAGGCCATAATGACATAATCAGGGTGACCTTCAAATAAGATGACACCATCGCACACCAGGATTGTTGTCGGGAGCGTCCTTGTCAAAGGAGCAGCAAACACGAGATTTCCCACGCGGACGGGGTCTGTACTTAACCTCTGCTTGTGCGAGCTGCTGTCTCACGCTTTCGGTCACGTGTGAAAAGAACACAAAGTCAGGAGCATGTGTGTGCAGCTTAACGACCTTCCTTTTGTTACGAAGTTCTTTTTTCCAAAAGAACACCAAAATAGCCTTGATTTGAAAATAGACTCTTTCAAGTGTTACTAAAATTCAACAGAATCAAACCTCAGTGCTCAGTTCGTTACCCTACCAACATTCTAACCCAGGTCGACGAAAGATGTACCTTTACTTTTTTAAAAGAACAATAAAACCAAAAGAAACTAATTTTCAC