Transcript asmbl_2579

Sequence
Transcript Sequence for observation asmbl_2579 of TGE0004121:
CTTTTTCATCCATTTTGTTAATGGTGGGGATTCACATCATTTCCAGTTCTTTTTAGGCTAGTATATATTGAATCTGTAAGTAACATTGTGGTTTCTTCCCTCTGGTAATGGATCAACCTCCAGTGATGACTATGACTCCAAGAAACGCAAACAGCGGGCTGGTGGAGAGCCTTGGGGTGCTAAGAAACCAAGGCATGACCTGCCTCCTTACCGGGTCCATCTTACTCCCTATACCGTGGATAGCCCCACCTGCGACTTCCTAGAACTCCAGCGCCGTTACCGCAGCCTCCTGGTTCCCTCAGATTTTCTGGCTGTTCATCTGAGCTGGCTGTCAGCCTTCCCTCTGAGCCAGCCTTTTTCCCTCCATCACCCAAGCCGTATCCAGGTATCTTCTGAGAAGGAGCCAGCTCCAAACAGTGGTGCTGAGCCCATCCCTGCAGACAGTGACCCTGCTTACAGTTCCAGGGTGCTGCTGCTGTCCTCCCCGGGACTGGAGGAATTGTATCGTTGTTGCATGCTTTTTGTGGATGACATGGCTGAGCCAAGGGAGACTCCAGAACACCCTTTGAAGCAGATTAAGTTTTTGCTGGGCCGGAAAGAAGAGGAGGCAGTGCTTGTTGGGGGTGAGTGGTCTCCTTCCCTGGATGGCCTCGACCCCAAGGGCGACCCGCAGGTGCTAGTCCGCACGGCCATCCGCTGTGCACAGGTGCAGACTGGCATCGACTTGAGCGCCTGCACAAAGTGGTGGCGCTTTGCTGAGTTTCAGTACCTGCAGCCGGGACCCCCGAGGCGGCTCCAGACTGTGGTGGTCTACCTGCCGGATATCTGGACCATTATGCCCACTTTGGAAGAGTGGGAGGCCCTGTGCCAGCAGAAAGCTGCAGAGGCAGCTCCTGCAGCCCAGGAGGTGCCAGTGGAAACAGAGCCTACAGAACAGGCAGCTGACGCGTCAGAGCAAGCAGCAGACGCCTCTAAACAGAACGCAGAGAACCCGGAGGTCACTGCACAGCAGGAAATGGACACCGACCTCCCAGAGGCCCCTCCACCCCCTCTAGAGCCTGCTGTCATGGCACGTTCTGGCTGTGTAAACTTGTCCCTCCATGGTATTGTGGAGGACCGGAGGCCAAAAGAAAGGATCTCTTTTGAGGTGATGGTGCTGGCTGAGCTGTTTCTGGAGATGCTACAGAGGGATTTTGGCTATAGGATTTATAAGATGCTGCTGAGCCTTCCTGAAAAGGTTGTGGCCCCACCTGAACCTGAGAAGGAGGAGGTGGCCAAGGAGGAAGAAGTGGTCAAGGAGGAGGTGGCCAAGGAGTCCAAGGATGAGGTACAGAGTGAGGGCACAGCTGCCGAGTCAGACGCCCCGCCGAAGGAAGATGGGCTTTTGCCCAAACCCCCATCTTCTGGGGGAGAGGAGGAAGAAAAGCCCCGGGGCGAGGCGTCGGAGGACCTCTGTGAGATGGCCCTCGACCCAGAGCTGCTGCTGCTGAGGGACGATGGAGAGGAGGAGTTCGCAGGGGCCAAGCTGGAGGATTCCGAGGTCAGGTCGGTCGCCTCAAACCAGTCAGAGATGGAGTTCTCTTCCCTTCAGGACATGCCCAAGGAGCTGGACCCCTCAGCCGTGCTCCCTTTGGACTGTCTTCTTGCGTTTGTCTTCTTCGATGCCAACTGGTGTGGCTACTTGCACCGGCGAGACTTGGAAAGGATCCTGCTCACTCTCGGGCTCCGGCTCAGCGCAGAGCAGGCCAAACAGCTGGTCAGCAGGGTGGTGGCCCAGAACATCTGCCAGTACCGCAGCCTTCAGTACAGCCGCCCGGAGGGCACGGATGGCGGGCTTCCCGAGGAGGTGCTCTTTGGAAACCTGGACCTGTTACCTCCTTCTGGGAAGAGCGCGAAGCCAGGAGCTGCCCCTGTGGAACACAAAGGCCTGGTGTCCCACAATGGCAGCCTGATCAATGTGGGGAACCTGTTGCAACGCGCAGAGCAGCAGGACAGTGGACGGCTCTACCTGGAGAACAAGATTCACACACTGGAACTGAAGCTGGAGGAGAGCCACCACCGTTTCTCAGCCACTGAAGTCACAAACAAGACACTGGCAGCTGACATGCAGGAGCTGCGCACCCGGCTGGCTGAGGCTGAGGACACGGCCCGGACAGCTGAACGACAGAAGAACCAGCTTCAGCGGCTGCTGCAGGAGTTTCGAAGGCGCCTGACCCCCCTGCAGCTGGAGATGCAGCGAATGGTTGAAAAGGCTGACAGCTGGGTAGAGAAGGAGGAGCCAGCACCTAGCAACTGAGGGGCCTGGCGCAGGAGTTGCCTTCCTGCGAGGTCAGCAGTGGAGCGTGCTGGAGTTAGAGCCCTTTGGTTCCAGAAAGAAGCTGGAGCAGGACCTGGGAGCCATAGGCGGGGTGGCTGACCCTGTGCTCAGCCCATGTAGGGGCACTCAGGCTGTCCGGGTGGGGTTTGCCTGTGCTGCGTGGGATGGACGGGTGAGGAACCGGTTCCACTTAAACTAAATCTAACATCTTCTGCACCCCTCGAATGTCATTTTTGCCCTCTACCTTGGGGTTTCTCCTGGGGCCCTTTAGTCTTGTGCTCTCTCCTGTCCTCTTCCAGTTTAGAGTAAGACGGGAGGAAAAGGCTTTTCGACTATGTCATAAGGTCTGATGCCAATAAACGGAAGAAACAGATGCGAGATCTGGCTGGGGTAAGAGCCCCTTCGTCTGGACGGCACAAGTCCTGCCAGGTTACAGGAGCAGGTTCTCGAGGGAAGGGTCTCTCGTGGCCTTTGCAGGAATGGACTCAGTGCTAGTGAGCTCTCACTGTTGGGCTGTTGCCAGTGGACACTGTTCCAGCCACCCCAGACTTGCCAGAAGAAACCAGCACCTCTGCCCCCTGGCTCCCCGTGTTCAGAATGTGGTATTGGCTCTGGCCCAGCCTTTTTCCCTGTTCCCCATAAGTCTCGCCTCTTTCCATACTGTGGTTTCAGTTTGACTTTGTATATAAAGTTTGTTTTTTT