Transcript asmbl_15684

Sequence
Transcript Sequence for observation asmbl_15684 of TGE0003840:
CTGGGCAATAGGACTTCCGGAAATCTGTGCCGGAGCACCCCTGCTTCCTAATCAAAGGTCTTGCGAACACAGACCAGGACGCCGCAGGTTCTTTCTCCGCTGCCACCGCTCGCAAAGCTTTCCCGACCGACATGCCGTTCGTTGAGCTGGACACGAACTTGCCCGCCAACCGCGTGCCCGCGGGGCTGGAGAAGCGGCTTTGCGCAGCCAGCGCCGCCATCCTAGGCAAACCCGAGGACCGCATGAACGTGACGGTGCGTCCGGGCCTGGCTATGGCGGTGAGCGGCTCGGCCGAACCCTGTGCTCAGCTACTTGTCTCCTCTATCGGTGTAGTGGGCACTGCCGAGGATAACCGCGGCCACAGCGCCCGCCTCTTTGAGTTCCTCACCAAGGAGCTGGGACTAGGCCAGGAACGGATAATTATCCGCTTTTTCCCCCTGGAGCCCTGGCAGATTGGCAAGAATGGGACAGTCGTGACATTTTTATGATTGGCATGGAAGACATCCGGGGTATCTGTGAGCTGGCCACCTCTTCCAGAGAGGCCTCCTGGCATAGTGAAGGCCTGGTTGATCCCAGCTTCTGGCATCCCCACATGCAGATATGTCTGTGACCTCACAGTCCTCTTCATCTCCATCCTTATTCCAAATAAATGAAGAGAGCTTTGTCTTTCAAA