Transcript asmbl_25561

Sequence
Transcript Sequence for observation asmbl_25561 of TGE0004288:
CGCACCGCGAATCACTTGTCAGCGCTCGTCTGAGGCGGAGGCAGCGCCGCGCCGGACCCGAGTTTCTTTCACTTTCTGGGATTGAATTTTGAGCCATCAAAACCATGAGCAACTACAGCGTGTCCTTGGTTGGTCCTGCTCCTTGGGGTTTCCGGCTGCAAGGTGGCAAAGATTTCAACATGCCTCTGACAATTTCTAGTTTAAAAGATGGCGGCAAAGCCTCCCAGGCGAATGTGAGAATAGGTGATGTGGTTCTCAGCATCGATGGAATAAGCGCCCATGGAATGACTCATCTTGAAGCCCAGAACAAGATTAAGGGTTGTACAGGCTCTTTGAATATGACTCTGCAAAGAGCATCTGCTACACCCAGGCCCGAGCCGGTTCCTGTTCAAAAGGGAGAACCTAAAGAAGTAGTTAAACCTGTACCCATTTCATCTCCTGCTGTGTCCAAAGTCACTTCCACAACCAACATGGCCTACAATAAGACACCACGGCCCTTTGGTTCTATGTCTTCACCAAAAGTCACATCCATCCCATCACCATCGTCCGCCTTCACCCCGGCCCACGCGACCACTTCATCACATGCTTCCCCTCCCGTGGCTGCTGTCACTCCTCCCCCATTCGCTGCATCTGGACTGCATGCTAATGCCAATCTTAGTGCTGACCAGCATTCACCTGCACTGAGCGCTGGTAAACCTGCAGTTAATGTCCCACGGCAGCCCACAGTCACCAGCGTGTGTTCCGAGACTGCTCAGGAGCTAGCAGAGGGACAGAGAAGAGGATCCCAGGGTGACAGTAAACAGCAAAATGGCCCACCGAGAAAACACATTGTGGACCGTAACACGGAGTTTTATCACATACCCACCCACAGCGATGCCAGCAAGAAGAGACTGATTGAGGATACAGAAGACTGGCGTCCGAGGACGGGCACAACGCAGTCTCGCTCTTTTCGAATCCTGGCCCAGATCACTGGGACTGAACATCTGAAAGAATCTGAAACTGATAATACAAAGAAGGCAAACAACACCCAGGAGCCTTCTCAGCATTTGGCTCCATCAGTAGCTTCAGCACGGAGCATGCCTGAGAGGCCAGGAAGCCCAGCCTCTGCCAGACCAGGGGTGGCTGGTCTCACAACTGCTGCTGCCTTCAAGCCTCTAGGATCCACCAGCACCATCAAGTCACCAAGCTGGCAACGGCCAAACCAAGCAGCACCTTACACTGGAAGAATCTCAAATAGTGCAGCTTCCTCAGGAGCAGTGGGACCAGCCGCCTCCTCTGTGGGGCAGCCCCAGCCAAGTGACCAGGACACTTTAGTGCAACGAGCTGAGCACATTCCAGCAGGAAAACGAACTCCAATGTGTGCCCACTGTAACCAGGTCATCAGGGGACCATTTCTAGTGGCACTGGGGAAATCTTGGCACCCAGAAGAATTCAACTGTGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTGGAGGAAAAGGGGGCCCTGTATTGTGAGCTCTGCTATGAGAAATTCTTTGCTCCTGAATGCGGTCGATGCCAAAGGAAGATCCTTGGAGAAGTCATCAATGCTTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTGGCCTGTGGAAAACCCATTCGTAATAATGTTTTTCACTTGGAGGATGGTGAACCCTATTGTGAGACGGATTATTATGCCCTCTTTGGTACTATATGCCGTGGATGTGAATTTCCCATAGAAGCTGGCGACATGTTTCTGGAGGCTCTGGGCTATACCTGGCATGACACTTGCTTCGTATGCTCAGTATGTTGTGAAAGTTTGGAAGGTCAGACCTTTTTCTCCAAGAAGGACAAGCCTCTTTGCAAGAAACATGCTCATGCTGTGAATTTTTGAAAGTCAACAGTTCAAGAGAAGAGAAGAAATTTGAAAAGAAAGAGGAGAATTAAAATTACCAATTAATTTTTAGATTTAATATTTATATGGAGTTTGAAAAATAATAGTGGCCCTGAAGGGATAAATTCCAGCTTTAAAAACCGAGTCTTTGAAGAAATATTTGGCTACATAACGTAAAGAGACAGTTTGGCATTTATTATTACTTTTTTCCCTGTATTTTCTGCCCATAAAATAACTTTCATAAAAATCAATTTCCTGGTTGACTATTAAATTCATCTTAGAATAAATTAGTAAAGAATTAAATTTTAGAAAATCTCAAACCTCTATGCTGAAATAATTATGGTTTCTTTCCTTGTTATGAGTAAATCTGTAAAAGGCAATGAAAGTGCCTTATACTTTTATCATTAAATGAAACATTGTATTTTTTTTAAGAATAATGTTTATCTTTAAAACAGTAAATAGGAGTTTAAACAGAGCATTTTATCAGTAGGTGTCAATTTTTACAAACTGTGTACATTTTTTTTGTCTTACAATCGATCATTCCAGTAGGAAAGATCAATGAGATTTTTCATCAAAATGCATCATGCCAATAAGAGATGCTATATTTTTCTTCATCCCTTTCAAAAGCTACCTACCATATGGCTTATAAATCTCAAATTTTTGCCTTTTATTAAAATATGGCCATTCCTATTCATTGTGTGTGTTTTATCGCCTATATTAGTCAAACTCTTTTTACCCCCGCTCCTTCATGCTGAGGTAAAGAGCTAATTGGATAACTTTGGACTGTAACAGTTTTCTCTCTATATAAAGAGAATAAGTAGGAAAGAATGTGGTTGTATCCAAAATATTCTCCTCCCCAATTCAGATCATGAATCGGTTTCAGAGTTGTACTACTGACAAGTGAAGGTTTGAGAACTCTCTTTGCAGAGTATTTTTTTCTTTAATTCTACATTAGAAAAATAAAAGATTGGCTTGGGGATGTGATAAAATCTTGATTGTTTTTTTCTTTTGATCATTCTCTTTCAGTAATAAATGAACCACTTCTAAAGGTGATCATGAAGTTTGGAAACTTTTATTCACAGAGGTTTGGTAGTATAGGAGGGCATATGATTAATTACTCAGACTAGCCCATTATTTGTTTTCTTCATTTGGGGAAAATTATGTGGATACCACATGAAGACAGAGAAACAATTGTGGTAAAATTGTAGATCCTATTGATATTTGCCCAGTGAGAAAAGCAATTATGGCATTTGATAGTTTTTCTCTTTGTTTTCAGATATGATGAAAGCCCATGATCCCACTAAGTTATAATTTAAATTCATTTGGAGCAAGATGCTTTTAAAGTTGAGGCTGAACCCGAAGTCTTTCCTGCCCCATCATCACTCACTAATTACTTCACTTCCATTGTGTACATGTTTGTTATAGAGGGAGGTTTTAAGCTACAATATTTGTTTAACCTCCCTAAGAACTTTTCAAGGCATCTGTCCTGAAAGTTGTTAATATATGGTCTAGCAGATTTAAATTATATACAGATAATAATTAACTGGGGATAAAAGAATGAGAAGGATGACACAAAGTGGCAAACTGAATACTTCACTTATAGTAACCCCAAACCACCTCCTCACCTTGCATCTTGCAGGGAGGCAGGAAGTTTTTTTGTTTTTTTTGTTTTTTAAGTGCTGTAACTGAATCATGCATTATTTTTCATTGCTGCTGAAACTACCTATAGAAGACATGCTGGCTAATGTGCCTTGTCACATATCTTGATGTCAGCCTTTTGCTTCACACAGCATAAAATAAGTTGGTGGTTTTGTTTTGATGTGGTAGAAGTTTTTTTTGTTATTTAGTTTTGCATTTATGGATTTTATATACAAAAATTGTATTTGGTAAGTCAGTGGTAGTTCCTTCAAAGAATTTTATTTGACCTGGGTTTCTTATAAAGTTATATTAACAATATCATTTTTATAGACTTTTCTTTCTACATATTATTCATGGAGCATAATGTTGCATTTCTCTAAATTTTATCTCGAAAAAGGTAACATTACATCCTAATTTATCATTTTGTCTTTGTGCTTTGTCCTTCTCTTCTGTGACAGAGCTTTATATCTATAACTAAAACAGTTAATCCTGTGAAATAAATATTGATCATAACCCAGAAGAATCTCTATTTTCCAGTGGGGAATGCCATATTTAACATACCAGCATTAATCTTTTAATAACTGGCAGAGCACTTTATTCTTCTGGCGAGCTCCCTGAATATTTATTTTTCTGATTATAAATATTCCGAGTCAGTAGCATTTTTTAAATTATTACGTCTTCACTGTAGAGCATTTACTTTTAGTCTCTTTAGATGTATATTTTGAAATGCTGTACTTAGTATAATATAGATTAAAATCATAGTACATAACTTTAAAACATCCCTTATTTGGATTTCTCTGTTTCAAAATGCTAGTGATAGGTTCAAATTTCTCTAGACTTACAAGGACAGAACGTTGCCCGCCATAGTAGCAGCCAAAAAATGGTCTTCTGTGCTTATGTTTATAGTAGCTTACACATTTCTATTGATTCAGGTTACATTAAGAATCTAAAACTAAAACTTAATTGTCTGGTCAGTATTAAGACAAACAAATAGTTTTAATCTTCAAATTATTAGTGCAGCATTATGTTTAAAAATTACCTACGACAAAATGTGTTAATGATACCATTTTCAAGGGGTACTATATTAGGACCACTTTTATAGAAAATAATTCCTCGGCCTCCGAATCTAGTAGTATGTTAACATTTTTGTGATGATTCAAAGGAGAGGCTTTTCAGACATAGGGAAGGGAAAACATACTGAATAATTTCACACAGATCTAACGTGGCTTCAGTTTGTCACTCTTCATCCCCTAATGTTTTAAGGTATTGGGTTTGAATTCTCAATGTATCATTTGCCTTATCTATTAATCTCTACTTTCTGTTTCTTTACGTTTTTAATTTTATATACGTCTATGCTGTTTTGCTTTTGCTTTTGGATGTATTTTCTAATTAAAAACCATGTGAGAAGTGTAATCAGTATAGTAATACCTTAATGAGCACATAATAAAT