Transcript asmbl_25558

Sequence
Transcript Sequence for observation asmbl_25558 of TGE0004287:
ACTACGCGCTCATTGGGTTTCTCCGTGTTGTTTTGGGAGGTCCCGGCCCGGCTCCCGTCGCCCCACTCCAGGAATTATTTTTTCCTTTTCAACCTTTGTTGTAACGCACTGAGACTGCAAGACTATAGTTCATTTAAAATTCCCAAGGGTGGTGGTTTCTACCAATATGAATCTTTTCAACCTGGACCGTTTTCGCTTTGAAAAGAGGAGTAAGATTGAGGAAGCGCCCGAAGCAACCCCTCAACCCTCCCTGCCTGGCCCTTCTTCACCAATTTCTCTTAGTGCTGAAGAGGAGAATGCTGAAGGGGAAGTTAGCAGGGCAGGCACCCCTGATTCAGATATAACTGAAAAAACAGAAGATTCTAGTGTTCCAGAAGCTCCAGTAAATGAAAGAAAAGCGAGTATATCATATTTCAAGAATGAGGGAGGAATACAGTATATTGATTTGTCTTCTGACAGTGAAGATGTTGTTTCCCCAAACTGTTCCAATACAGTTCAAGAGACAAAATTCAACAAAGACACAGTGATTATAGTTTCTGAGCCATCCGAAGATGAAGAGTCCGAAGGCCTTCCTGCCATGGCAGGTAGAAATAATGACGATATTTCAGAATTGGAAGACCTTTCGGAATTAGAAGATCTTAAAGATGCTAAACTTCAGACCTTGAAGGAACTTTTCCCACAAAGAAGTGACAGTGATTTACTTAAGTTGATTGAATCAACCAGCACGATGGATGGGGCAATTGCTGCTGCGTTGCTGATGTTTGGTGATGCAGAAGGTGGCGGACCCAGGAAAAGAAAATTATCTTCTTCTTCAGAGCCATATGAGGAAGATGAATTTAATGATGATCAGTCCATAAAAAAGAAAAGACTAGATCATGGAGAGGAATCAAATGAGTCTGCCGAATCTAGCAATAATTGGGAAAAGCAGGAAAGTATTGTATTGAAATTACAAAAGGAATTTCCCAATTTTGATAAACAGGAACTAAGGGATGTACTCAAGGAACATGAATGGATGTACTCAGAAGCTTTAGAATCTTTAAAGGTATTTGCAGAAGACCAAGATATGCAATATGCTTCACAAAGTGAGTTTCCAAATGGAAAAGAAGTTTCTTCAAGGAGTCAAAATTATCCTAAAAGTGTAACTAAAACAAAATTAAAACAGAAATGTGCCATGAAACCACAAAATGGTTTTAACAAGAAACGTAAAAAAAATGTATTTAATCCTAAGAGAGTCATTGAAGACTCTGAATATGATTCAGGTTCTGATGTCGGTAGTTCGCTAGATGAGGACTATAGTAGTGGCGAGGAAGTGATGGAGGATGGCTATAAAGGTAAAATTCTTCACTTCCTTCAAGACGCTTCAGTTGCTGAACTTACTTTGATTCCTCAGTGTTCTCAGAAAAAGGCTCAGAAGATAACAGAACTCCGGCCCTTTAATAGTTGGGAAGCTCTGTTCACAAAGATGTCCAAAACTAATGGCTTGTCAGAAGATTTGATATGGCACTGTAAAACACTGATCCAAGAAAGGGATGTAGTTATAAGGCTTATGAACAAATGTGAAGACATTTCTAATAAATTGACAAAACAAGTTACCATGCTCACTGGAAATGGAGGTGGATGGAACATAGACCAACCCTCCATTCTGAACCAAAGTTTATCACTCAAGCCCTATCAGAAGGTTGGTTTGAATTGGTTGGCATTGGTACATAAACATGGACTTAATGGCATTTTGGCAGATGAAATGGGCCTAGGAAAAACTATTCAAGCCATTGCATTCCTGGCATACCTGTATCAGGAGAGTAATAAAGGTCCTCATTTGATTGTTGTTCCAGCATCAACTATAGATAACTGGTTAAGGGAAGTTAATTTATGGTGCCCCACTTTAAAGGTGCTCTGTTACTATGGTTCTCAAGAAGAACGTAAACAGATAAGATATAACATTCATAGTAAATATGAAGAATACAATGTAATTGTGACCACGTATAATTGTGCAATCAGCAGTTCTGATGATCGCAGTCTCTTTCGGCGACTAAAACTTAATTACGCAATTTTCGATGAGGGCCATATGCTGAAGAATATGGGCTCCATTCGCTACCAGCACCTTATGACAATTAATGCAAATAACCGTTTGCTGCTCACAGGCACACCTGTACAGAATAATCTGTTAGAACTCATGTCACTGTTGAATTTTGTTATGCCACACATGTTTAGTAGTAGCACCAGTGAAATACGAAGAATGTTTTCTTCTAAGACAAAATCAGCAGATGAGCAAAGTATATATGAAAAGGAGAGAATAGCACACGCAAAACAAATTATAAAACCATTTATTCTCAGAAGAGTAAAAGATGAGGTTCTCAAGCAGCTGCCCCCTAAGAAAGATCAAATTGAGTTGTGTACAATGTCAGAGGAACAGGAACAACTCTATTTGGGTCTTTTCAACAGATTGAAAAAATCTATCAATAACTTGGAAAAAAACACAGAAATGTGCAATGTCATGATGCAATTGAGAAAAATGGCCAATCATCCTTTATTACATCGCCAATATTACACAGCTGAAAAACTCAAGGAAATGTCTCAGCTTATGCTAAAGGAACCTACACATTGTGAAGCTAACCCTGACCTGATCTTTGAAGATATGGAGGTTATGACAGACTTTGAATTACATGTACTTTGTAAACAATATCGACACATTAATAACTTCCAGTTAGACATGGACTTGATTTTAGATTCTGGAAAATTCCGAGCTTTAGGACGCATCTTGTCTGAATTGAAACAGAAGGGTGATAGAGTTGTGTTATTTAGCCAGTTTACCATGATGCTGGATATTTTAGAGGTTCTCTTAAAACATCATCAGCATAGGTACCTCAGATTAGATGGAAAAACTCAGATTTCTGAAAGGATTCATCTAATTGATGAGTTTAATACCGATATGGATATCTTTGTGTTCCTGCTGTCAACGAAAGCTGGTGGCTTAGGAATAAACCTGACTTCAGCGAATGTTGTTATACTTCACGATATTGACTGTAATCCTTACAATGACAAACAAGCAGAGGATAGATGCCATAGAGTAGGCCAGACTAAAGAAGTATTAGTTATAAAATTAATAAGCCAAGGGACAATTGAAGAATCCATGCTAAAAATTAACCAACAGAAATTGAAACTAGAACAAGATATGACCACAGTAGATGAAGGTGATGAAGGAAGCATGCCCGCAGATATAGCCACGTTACTAAAAACGTCAATGGGCCTGTGAAGTAAGACTTGTGAATTCCTGATTGATGAGGAAATATCAACTTGGTGCACTCAAGGACATTTACATTATGGTGACCATGGGGTTTATGAACATTTATAACTTTTTATAATTTCCATATTACATTTCTCATAGTATGGACAACTTTTTTGCCACTAACCGAATTCTCCCGATGCTCACATGTGAAATTT