Transcript asmbl_15645

Sequence
Transcript Sequence for observation asmbl_15645 of TGE0003834:
CACCCGTGGCTGTGAAGGAGGCCTGAGAGCGACATGTCCCCGGCGGCTGAGGCAGAGCGGCCCGTGGCGCTGTTTGTCTGAGTCCAGGGCGGCCTGGCGGCCGGCTGAGGAAGAGGGTCGGCGGAGGCTGCCCCCGCTGTAGTGGCCGCCATGCTGGGGGCCCGGGCAGCTGAGGGAGTCGCCGTGGCGCTTCTGAGGCTGCTGCTGCTGCTGCTGCTGTCGGCGCTCCGGGGGCCGGGGCTCGGCGTGGTCGGCACGGCGGGGGCTGGGCTGTCGGACAGCGTTATTTGGGCGGTCAACGCGGGCGGCGAGGCGCATGTGGACGTGCACGGGATTCACTTCCGCAAGGACCCTTTGGAAGGCCGGGTGGGCCGAGCCTCTGACTATGGCATGAAACTGCCAATCCTGCGTTCCAACCCTGAGGACCAGATCCTATATCAAACAGAGCGGTACAATGAGGAGACCTTTGGCTACGAAGTGCCCATCAAAGATGAGGGAGACTATGTGTTGGTGTTGAAATTTGCCGAGGTCTACTTTGCACAGTCCCAGCAGAAGGTATTTGATGTGCGATTGAATGGCCACGTGGTGGTGAAGGACTTGGATATCTTTGATCGAGTTGGGCACAGCACAGCTCATGATGAAATCATCCCTATGAGCATCAGAAAGGGGAAGCTGAGCGTCCTAGGGGAGGTGTCCACCTTCACAGGGAAACTCTACATTGAGTTCGTCAAGGGTTACTATGACAATCCCAAAGTATGTGCACTCTACATCATGGCTGGGACAGTGGATGATGTACCAAAGCTGCAGCCTCATCCAGGATTGGAGAAGAAAGAAGAGGAAGAAGAAGAAGAAGAATACGATGAAGGGTCTAATCTCAAAAGACAGACCAATAAGAACCGGGTGCAGTCAGGCCCCCGCACACCCAACCCCTATGCCTCGGACAACAGCAGCCTCATGTTCCCCATCCTGGTGGCCTTCGGAGTCTTCATTCCAACCCTCTTCTGCCTCTGCCGGTTGTGAGGACAAATTACCATCCTGAACAGGGTGGAGGGTGTGGGAAAGAAACCAAACGTGTTGGTTTGGTTTCTGTATTTTTCATGGTGATTAACACACACACACACACACACACA