Transcript asmbl_24757

Sequence
Transcript Sequence for observation asmbl_24757 of TGE0004254:
GCAAATCAGCCTTCTTTAGTCAGTCAGATAAGCTCAGAGCTGGAACAAAGGTGCCATATGCTGCGGTTCCTGTAACGACAGACGATCAGCTGCCATCTGTCTTCTGGAGGTCACCCCTCTAGGGTCTCTGGGGAACAATGGGAGTCTTGGGCTTCCTCACACTGGAAGCGAACGGCCCCATGCTGACAGTGGCCCTGTCTGTGGTCCTCTTGGCTCTCCTGAAATGGTACTCTACGTCAGCCTTTTCAAGACTGGAGAAGTTGGGCATCAGACATCCCAAGCCTTGTCCTTTTATTGGAAACTTGACATTTTTCCGCCAGGGCTTCTGGGAAAGTCAGATGGAGCTCAGAAAGCTGTATGGACCTCTGTGTGGGTACTATCTTGGCCGTCGGATGTTTATCGTTATCTCCAAACCGGACATGATCAAGCAGGTGTTGGTCGAGAACTTCAGTAACTTTACCAACAGAATGGCATCGGGTTTGGAATCCAAACCGGTAGCAGACAGCGTGCTGTTTTTACGTGACAAAAGATGGGAAGAGGTCAGAAGTGTTCTAACTTCTGCTTTCAGTCCTGAGAAGCTGCATGAGATGATTCCTCTAATCAACCAAGCCTGCGACCTTCTCCTGACTCATTTAAAACACGATGCGGAACGTGGAGACGCTGTCGACATCCAGAGGTGCTACAGCTGCTACAGCACAGATGTGGTGGCCAGTGTCGCCTTCGGCACCCAGGTGGACTCCCGAAAGGCTCCTGAGGACCCCTTTGTCAAGTACTGCAGGCGTTTCTTTGCCTTCGGCATCCCCAGACCTCTCCTGGTTTTCATCGTATCATTTCCATCCATAATGGTCCCACTGGCCCGGATTTTGCCCAATAAGAACCGAGATGAACTGAATGGCTTTTTTAACAAACTCATTAGGAATGTGATTGCCTTGCGGGACCAGCAAGCAGCAGAAGAGAGGCGGAGAGACTTCCTCCAAATGGTCCTGGATGCCCGACAATCCACCCCTTCCGTGGGCGTGGAGAGCTTCGACATAGTCAGACAAGTCTTCTCATCCTCCGAATGCTCAGCGAATCCTTCCCAGCAAGGCCAGCCCAGACCCCTGTCCAAGCCCTTGACTGTGGATGAGATCGTGGGCCAGGCCTTCCTCTTCCTCATCGCCGGCTACGAGATCATCACCAACACACTATCTTTCGCCACCTACCTACTGGCCACCAACCCTGACTGCCAAGAGAAGCTTCTGACAGAGGTGGACCGTTTCAACGAGAAATATGCGACCCCCGAGCTCTGCAGCCTCCAGGAAGGCCTGCCCTACCTGGACATGGTGATCGCAGAGACCTTGAGGATGTACCCGCCAGCTTTCAGGTTCACGCGGGAGGCGGCAAAGGACTGCGAAGTGCTGGGGCAGCGCATCCCCGCCGGCACCGTGGTGGAGATGGCCGTGGGCGCCCTGCACCGCGACCCGGAGCACTGGCCCCGCCCCGAGGCCTTCGACCCGGAGAGGTTCACGGCGGAGGCCCAGCGGCGCCGGCGGCCCTTCACCTACCTGCCATTTGGAGCGGGGCCCCGGAGCTGCCTCGGCGTGAGGCTGGGGCTGCTGGAGGTCAAGCTGACGCTGCTCCACGTCTTCCGGAAGTTCCGGTTCAAAGTCTGCCCCGAGACTCAGGTGCCACTGCAGCTAGAATCCAAATCTGCCCTAGGTCCGAAAAATGGTGTCTACATCAAGATTGTCTCCCGCTGACAGTTAAGAGGGCACCCCCTAATTCGAGGAAAACTTTCATGTGGAAATTCAGATATTTGGGGAGACATCACCTTAGCCATTGAAAGGGTGTCTGGAATGCAAGTATACAAGAAGTCATTTACATAACATGTCCTAAATGCTTAATAAATGTTTGCTGCACTTA