Transcript asmbl_24710

Sequence
Transcript Sequence for observation asmbl_24710 of TGE0026897:
TCGTCTACTAACCCGCCAAGATGCTCAAAGCCTCCTGGCTCCAGTCAAGTCTTCAGTTGTCGGTGTGGAAGGCTGCCCTGCATTGCCACACAAACTTGTGGCAATATGTGACATTTCAGCTGACACAGGAGGGTCTATCGAGTTTATGACCGAGTGTACAACAATAGAGCGTCCTTTTTGCATGTATGATGCAGACCAGCATATTATTCATGACAGTGTTGAAGGCTCTGGGATTCTGATGTGTTCCATTGACAATTTGCCAGCACAGCTTCCAATTGAAGCTACAGAATACTTTGGTGACATGCTTTATCCTTATGTCGAAGAAATGATATTATCAGATGCAACACAGCCTCTTGAAAGTCAGAATTTTTCTCCTGTGGTGAGAGATGCAGTGATTACATCCAACGGTACATTGCCTGATAAGTATAAATATATCCAGAAACTCCGAGAGAGCAGGGAACTTGCTCAGTCACTTTCAATGACTACCAAGAAAAAGGTCTTGGTTCTTGGAAGTGGTTATGTATCTGAGCCTGTACTGGAATATCTGTCGAGAGATGACAACATAGAAATAACAGTAGGCTCTGACATAAAGAATCAAATTGAACAGTTAGGCAAGAAATATAACATTAGTCCTGTTATCATGGACATTGGTAAACAAGAAGAGAAATTGGTCTCCTTGGTGGCAACACAAGATCTTGTCATCAGCTTGTTGCCTTATGTATTGCATCCTCTTGTGGCCAAGGCATGCATCACAAGCAAAGTTAACATGATCACTGCAAGCTATATCACACCAGCACTAAAAGAATTAGAGAAGAGTGTGAAAGATGCTGGCATCACAATCATTGGAGAATTGGGATTGGACCCTGGTCTTGATCACATGTTGGCAATGGAAACAATAGATAAGGCCAAAGAAGTAGGAGCCACGATTGAATCTTATATTTCCTACTGTGGTGGGCTTCCAGCCCCTGAATATTCAGACAATCCTCTGAGATACAAGTTTAGCTGGAGTCCCACGGGAGTCTTGATGAACATAATGCAGCCCGCCACCTACCTCCTCAATGGCAAGGTTGTGAATGTCAAAGGGGGCGTCTCCTTTCTCGATGCGGTTACTCCCATGGATTATTACCCCGGACTAAATTTGGAAGGCTACCCTAACAGAGACAGCACCAAATACGCTGAGGTTTATGGCATTCCCTCTGCTCACACGTTGTTGCGGGGTACACTGAGATATAAGGGATATGCCAAAGCCTTGAATGGGTTTGTGAAATTGGGTCTTATAAACAGAGATGCATTTCCTGCCCTTAGACCTGAAGCCAAGCCTCTCACCTGGAAAGAGCTCCTCTGTGATCTAGTTGGGATTTCACCCTCCTCCAAGTCCGATGTGCTCAAGGAAGCCGTCCTTAAGAAACTAGGAGGGGACAATACCCAGCTGGAGGCTGCTGTATGGAGAGTCCAATAACTTAAACTGTCATC