Transcript asmbl_24709

Sequence
Transcript Sequence for observation asmbl_24709 of TGE0026896:
TCGTCTACTAACCCGCCAAGATGCTCAAAGCCTCCTGGCTCCAGTCAAGTCTTCAGTTGTCGGTGTGGAAGGCTGCCCTGCATTGCCACACAAACTTGTGGCAATATGTGACATTTCAGCTGACACAGGAGGGTCTATCGAGTTTATGACCGAGTGTACAACAATAGAGCGTCCTTTTTGCATGTATGATGCAGACCAGCATATTATTCATGACAGTGTTGAAGGCTCTGGGATTCTGATGTGTTCCATTGACAATTTGCCAGCACAGCTTCCAATTGAAGCTACAGAATACTTTGGTGACATGCTTTATCCTTATGTCGAAGAAATGATATTATCAGATGCAACACAGCCTCTTGAAAGTCAGAATTTTTCTCCTGTGGTGAGAGATGCAGTGATTACATCCAACGGTACATTGCCTGATAAGTATAAATATATCCAGAAACTCCGAGAGAGCAGGGAACTTGCTCAGTCACTTTCAATGACTACCAAGAAAAAGGTCTTGGTTCTTGGAAGTGGTTATGTATCTGAGCCTGTACTGGAATATCTGTCGAGAGATGACAACATAGAAATAACAGTAGGCTCTGACATAAAGAATCAAATTGAACAGTTAGGCAAGAAATATAACATTAGTCCTGTTATCATGGACATTGGTAAACAAGAAGAGAAATTGGTCTCCTTGGTGGCAACACAAGATCTTGTCATCAGCTTGTTGCCTTATGTATTGCATCCTCTTGTGGCCAAGGCATGCATCACAAGCAAAGTTAACATGATCACTGCAAGCTATATCACACCAGCACTAAAAGAATTAGAGAAGAGTGTGAAAGATGCTGGCATCACAATCATTGGAGAATTGGGATTGGACCCTGGTCTTGATCACATGTTGGCAATGGAAACAATAGATAAGGCCAAAGAAGTAGGAGCCACGATTGAATCTTATATTTCCTACTGTGGTGGGCTTCCAGCCCCTGAATATTCAGACAATCCTCTGAGATACAAGTTTAGCTGGAGTCCCACGGGAGTCTTGATGAACATAATGCAGCCCGCCACCTACCTCCTCAATGGCAAGGTTGTGAATGTCAAAGGGGGCGTCTCCTTTCTCGATGCGGTTACTCCCATGGATTATTACCCCGGACTAAATTTGGAAGGCTACCCTAACAGAGACAGCACCAAATACGCTGAGGTTTATGGCATTCCCTCTGCTCACACGTTGTTGCGGGGTACACTGAGATATAAGGGATATGCCAAAGCCTTGAATGGGTTTGTGAAATTGGGTCTTATAAACAGAGATGCATTTCCTGCCCTTAGACCTGAAGCCAAGCCTCTCACCTGGAAAGAGCTCCTCTGTGATCTAGTTGGGATTTCACCCTCCTCCAAGTCCGATGTGCTCAAGGAAGCCGTCCTTAAGAAACTAGGAGGGGACAATACCCAGCTGGAGGCTGCTGTATGGTTGGGCTTGCTTGGGAATGATCAGGTCCCTCGGGCAGAGTCTGTTGTGGAAGCGCTCTCCAAGCATTTAGCCACAAAACTTTCGTACGGTCCCGGAGAGAAAGATATGATTGTGATGAGAGACAGCTTTGGAATCAGACATCCTTCTGGACATTTAGAAAGTAAAACTATTAATCTCGTGGTTTATGGAGACACCAAAGGCTTTTCAGCCATGGCTAAAACTGTGGGATTACCCACCGCGATGGCAGCCAAGATGTTGCTTGATGGTGAAATTCAAGCTAAAGGCCTGATTGGGCCCTTTTCAAAGGAGATCTATGGACCAATATTGGAGCGAATTAAAGCAGAAGGCATTATCTATACTACACAGAGCACAACCACACTTTAATTGAGAATTATTTTGTTTTTACCTTCTCAGGCAACACAGCTCTGAGCATTTGTGCAACAACCATGTTTGCTACTGTGCTGTTTTAAACTACAAAACATGATATGTTTTTGAATAAGTCATTACAGTGATGTTTTTGAAATATAAATGTCTATTTTAATATGAAAACATTTGAAACAGGAAATGCCAGTGATAGAGAACTTTAATAATTCTACTATGTATTTTTTCACATGTATGTAGAAGTGATAATGAGTTATTAATTTATTGTGCAACTTTTTTCCTACAAGAATATATTTTCCTATACTCAGCAGATGCAGTTTTATCTTTTTAGATATAAAAAAGTTTCCTCAATAACATAGCAATGCAAAGGATCATAAGAGACTACTACAAACAATTATATGCCAATACACTGGAAAACCTAAAAAATGAATCAGTTCCTAGAAACATACAACCTTCCAAGACTGAATCATGAAGAAATAGAAAATAGACCAATTATAAGTAATGACACTGAATCAGTAATTTAAAAACTCCCCAAAACAAAAAGTCCAGGACCAGATGGCTTCACAGGTGAATTCTACCAAACATTTATGAAGAGTTGACACTTACCTTTCTTAAATTATTCCCAAAAAATTAGTGAGGAAGGAACACTTCCAAACTCCTAGGAATAGATTGAGAGTCTAGAAATAACCCTCACATTTATGGTCAACTGATTTTTTAAAAGGGCGCTAAGACAGTTTAATAGAGGAAAATAGTGTTTTCAACAAATGGTGCTGGAACAGCTGGATATCCACATGTGAAGGAATTGGAAATTGGACCCTTACCTCACAGTCAAAATTAATTCAAAGTGAACCAAAGGCCTAGTTACAAGGGCAAACACCATAAAACTTTTAGAAAAAGTCATAGGCATAAATATTCATGATCTTGGATTGGATAATGGTTTCTTAAGTAAATGACACCGAAAGCATGAGCAATAAAAGGAAAAAAATACATAAATTGAACAGCATCAGAATTAAAACTTTTCTGTTTCCAAGGATACCATCAAGAAAGC