Transcript asmbl_24708

Sequence
Transcript Sequence for observation asmbl_24708 of TGE0026895:
TGCAGTCCTCAGAAGTTGAGCAAACATCTCTCCGCTCCATCCCAATTCTGTTGGGACTTCGGGGCCTACCCTGTCCGGACCCGGGAGCTGGGAGGCGGCGAGACCGGTCTGCGCCCCCGAGAGGACGAGTCACCAGGTTTCAAGATGCTGCGAGTACGTAGGACCGAGCTGTGCAGGTTGGGGCTCGGCCTCTCCAGGGGGCTTCACCAACAGCCTGTGATGGCCCTGAGGCGGGAGGACGTGAACGCCTGGGAGAGGAGGGCCCCTCTGGCCCCCAGGCACATCAAGGGGATCACCAACCTGGGATACAAGGTCTTAATACAGCCTTCCAATCGGCGGGCCATTCATGATAAGGAATATGTCAAAGCTGGTGGCATTCTTCAGGAGGATATTTCTGAAGCCTGTCTAATTTTGGGAGTTAAAAGACCCCCAGAGGATAAATTAATGTCCAAGAAGACTTATGCATTCTTCTCCCACACAATAAAGGCCCAGGAGGCCAATATGGGCTTATTGGATGAGATTCTAAGACAGGAAATCCGACTTATTGATTATGAAAAAATGGTGGATCATAGAGGAATTCGGGTAGTGGCGTTTGGACAGTGGGCTGGTGTGGCAGGGATGATCAACATTTTACATGGAATGGGTTTAAGGCTCCTTGCTTTGGGACATCATACACCTTTTATGCACATTGGCATGGCTCATAACTATAGGAACAGCAGTCAGGCTGTGCAAGCTGTCCGTGATGCTGGCTATGAAATATCTCTGGGTTTGATGCCCAAGTCAATAGGGCCCTTAACATTTGTGTTCACAGGGACTGGCAATGTATCAAAGGGAGCCCAAGAAGTCTTCAATGAACTACCCTGTGAATATGTGGAACCACATGAATTAAAAGAAGTTTCTAAAACTGGTGACCTGAGAAAAGTGTATGGAACAGTGTTAAGTCGCCATCATCATCTTGTCAGGAAAACAGATGGTACATATGATCCCGTAGAATATGACAAATATCCTGAGCGCTACATAACTCGTTTTAATACCGATATTGCACCCTATACAACTTGTTTTATTAATGGAATCTACTGGGAGCAAAACACCCCTCGTCTACTAACCCGCCAAGATGCT