Transcript asmbl_24654

Sequence
Transcript Sequence for observation asmbl_24654 of TGE0015139:
GGTAGTGGCTCCAATCCTTTTCGGCATCTGGAGAAGAGCGCTGTTTTACAGGAGGCTCGTCTGTTCAATGAAACACCCATCAATCCAAGAAGATGTTTGCATATTCTTACAAAGATTCTTTACTTACTGAACCAGGGTGAACACTTTGGAACTATGGAAGCCACAGAAGCCTTCTTTGCAATGACTCGATTGTTTCAATCTAATGATCAAACATTGAGAAGAATGTGCTACCTTACCATCAAAGAAATGGCTAACATCTCTGAAGATGTGATAATTGTCACAAGCAGTCTGACCAAGGACATGACAGGAAAGGAAGATGTGTACCGAGGCCCGGCCATCAGGGCTCTCTGCAGAATCACCGATGGAACAATGTTGCAGGCCATTGAACGATACATGAAGCAGGCCATTGTGGATAGAGTCTCCAGTGTATCCAGCTCAGCACTGGTATCTGCCTTACACATGATGAAGATAAGCTATGATGTGGTTAAGCGCTGGGTCAATGAAGCCCAAGAAGCTGCTTCAAGTGATAATATTATGGTCCAGTACCATGCATTGGGAGTCTTGTATCACCTTAAAAAGAATGATCGCCTTGCTGTTTCGAAGATGTTGAATAAATTTACTAAATGTGGTCTCAAATCACAATTTGCTTACTGCATGCTGATCCGAATTGCCAGTCGCTTACTAAAAGAAAATGAAGAGGGTCACGAAAGTCCACTCTTTGATTTCATTGAGAGCTGCTTGCGAAATAAACATGAAATGGTTATTTATGAAGCTGCTTCAGCTATCATCCATCTACCTAACTGTACTGCAAGGGAGTTGGCACCTGCTGTTTCAGTTCTTCAGTTGTTCTGTAGCTCTCCTAAGCCAGCTTTGAGATATGCAGCTGTGAGGACCTTGAACAAGGTGGCGATGAAGCACCCCTCTGCTGTTACTGCCTGCAATCTGGATTTAGAAAACTTGATCACAGACTCAAACAGAAGCATCGCCACCCTTGCCATTACTACACTCCTCAAAACAGGAAGTGAGAGCAGTGTGGACAGGCTCATGAAGCAGATATCTTCTTTTGTGTCCGAAATCTCAGATGAGTTCAAGGTGGTGGTTGTGCAGGCAATTAGTGCTCTCTGTCAGAAATATCCTCGAAAGCACAGCGTCATGATGACTTTCCTCTCCAACATGCTCCGAGACGATGGAGGCTTCGAATACAAGCGGGCCATCGTAGACTGCATAATCAGCATTGTGGAAGAGAACCCAGAGAGCAAAGAAACGGGCCTAGCCCACCTTTGTGAATTCATCGAAGACTGTGAACACACTGTTCTGGCTACTAAGATTCTACACTTGTTGGGCAAAGAGGGCCCCAGAACGCCTGTCCCCTCCAAATATATCCGCTTTATTTTTAATAGGGTCGTACTGGAGAATGAGGCTGTCCGAGCTGCTGCTGTGAGTGCTTTGGCTAAATTTGGGGCTCAGAATGAGAATCTTCTCCCAAGCATCCTTGTACTCCTACAAAGGTGTATGATGGATACTGATGATGAGGTACGGGACAGAGCTACCTTCTATCTGAATGTGCTGCAGCAAAGGCAGATGGCACTGAATGCTACATATATCTTCAATGGTTTGACAGTTTCTGTTCCAGGGATGGAAAAAGCCTTATACCAGTACACATTGGAGCCTTCAGAAAAACCATTTGACATGAAGTCTATTCCTCTCGCTATGGCTCCTGTCTTTGAACAGAAAGCAGAAATCACACTTGTGGCTACTAAGCCAGAGAAGTTGGCTCCTTCCAGGCAAGACATTTTCCAAGAACAATTGGCTGCTATTCCTGAGTTTATGAATCTAGGACCCTTGTTCAAGTCTTCTGAGCCTGTTCAACTTACAGAAGCAGAAACAGAATATTTTGTTCGTTGTATTAAGCACATGTTTACCAACCACATTGTGTTCCAGTTTGACTGTACCAATACTCTCAATGACCAGCTACTGGAGAAAGTGACAGTGCAGGTGGAACCATCAGATTCCTTTGAAGTGCTGTGTTACATTCCCGCCCTCAGCCTCACATATAATCAACCAGGAATATGTTACACTCTTGTCCGTTTGCCCGATGATGACTCTTCAGCAGTTGCAGGCACCTTCAGCTGCACCATGAAGTTTACTGTCCGGGACTGTGACCCTGACACTGGGGTCCCAGCCGAGGAGGGGTATGATGATGAGTACGTGCTGGAAGATCTTGAAGTGACTCTGTCTGACCACATTCAGAAGGTCCTGAAGCCTAGCTTTGCTGCTGCCTGGGAAGAGGTGGGAGATACCTTTGAGAAAGAGGAGACCTTTGCCCTCAGTTCTACCAAAACTCTTGAAGAAGCTGTCAGCAACATCATCACATTTCTGGGCATGCAGCCATGTGAGAGGTCGGATAAAGTACCTGAGAACAAGAATTCTCATTCCCTCTATCTGGCAGGTGTGTATAGAGGTGGCTATGATTTATTGGTGAGGTCAAGGCTGGCCTTAGCAGATGGCGTGACCATGCAGGTGACTGTCAGAAGCAAAGAGGGAACACCTGTAGATGTTATCTTGGCTTCTGTTGGATAAGTTTTTTGGGGGGATGGGGCAAGATGAAGTTGATGTACACTTCACTGCAGTGGGCTTTTAGGGCTAGTGGCATGAATTTCCCAGAATCATACTTTGAAAAATTAATGACTTTGCAGAAGCAAATTAAATGTTTGGCCCTGAGCCAGCAGATCAAGCAAATATCTGTCCTTGTGCATGTCTTTTTATTACACTTGGTCAACTTTGGTATGATAGTACAGCTTCGGGTGATCTTGAAAAGCAAATACTATCCTGTACCCCAGCTGCTTAACTTCATTATATTGTTTAATTTAACGTGTGTCTGAAAGCTCCTGGCAATGTTGAAAAGCTTTTATCCCAG