Transcript asmbl_17150

Sequence
Transcript Sequence for observation asmbl_17150 of TGE0000387:
GCCGGAAGTTAAGGAGGGGAGGGGGTGGAGGGAAAAGCAAGCCAGGAGGTGCTTGCGGCCGCTTCTAGTAGTTTCCAGGCGCTGCCGGGCGGCTGGCACTAAGCGGTCCTGAGGCTGTGGCTACGGCTGCTCCGGAGCTGGTGGCGCCGCGATAGGAGAGCCGATGGCCAAGTGGGGTGAGGGAGACCCACGCTGGATCGTGGAGGAGCGGGCGGACGCCACCAACGTCAACAACTGGCACTGGACGGAGAGAGATGCTTCAAATTGGTCCACGGATAAGCTGAAAACACTGTTCCTGGCAGTGCAGGTTCAAAATGAAGAAGGCAAGTGTGAGGTGACGGAAGTGAGTAAGCTTGATGGAGAGGCATCCATTAACAATCGCAAAGGGAAACTTATCTTCTTTTATGAATGGAGCGTCAAACTAAACTGGACAGGTACTTCTAAGTCAGGAGTACAATACAAAGGACATGTGGAGATCCCCAATTTGTCTGATGAAAACAGCGTGGATGAAGTGGAGATTAGTGTGAGCCTTGCCAAAGATGAGCCTGACACAAATCTCGTGGCCTTAATGAAGGAAGAAGGGGTGAAACTTCTAAGAGAAGCAATGGGAATTTACATCAGCACCCTCAAAACAGAGTTCACCCAGGGCATGATCTTACCTACAATGAATGGAGAGTCAGTAGACCCAGTGGGGCAGCCAGCACTGAAAACTGAGGAGCGCAAGGCTAAGCCTGCTCCTTCAAAAACCCAGGCCAGACCTGTTGGAGTCAAAATCCCCACTTGTAAGATCACTCTTAAGGAAACCTTCCTGACGTCACCAGAGGAGCTCTATAGAGTGTTTACCACCCAAGAGCTGGTGCAGGCCTTTACCCATGCTCCTGCAACATTAGAAGCAGACAGAGGTGGAAAGTTCCACATGGTAGATGGCAACGTCTCTGGGGAATTTACTGATCTGGTCCCTGAGAAACATATTGTGATGAAGTGGAGGTTTAAATCTTGGCCAGAGGGACACTTTGCCACCATCACCTTGACCTTCATCGACAAGAACGGAGAGACTGAGCTGTGCATGGAAGGTCGAGGCATCCCTGCTCCTGAGGAAGAGCGGACGCGACAGGGCTGGCAGCGGTACTACTTTGAGGGCATTAAACAGACCTTTGGCTATGGCGCACGCTTATTTTAGGGCCAGCGGCAGGGGACTCCAGCCTGCTGGACACTTCAGTCCAGCTCTCTCCTGACTGGGGCTTGCGACTCACAGGATTGCATCGTCCCAGCTGCTAACTTGGGGCCGGGGCCCCTCCCTTCCACATATACCTTGGGTTTGTGCATGTTTTCTGCTGGGTGGGTTCAGAGGGCAATTTCTCTTTTATGTGTACATATGCTAAATAAACATAATTTAAAAAACA