Transcript asmbl_24535

Sequence
Transcript Sequence for observation asmbl_24535 of TGE0026878:
CGAGTGTACGCGTTGCCGGCGAAGAGGGGAGCCTGACGACTCGGAAATTTGAATACCACAGTAGCATGGAGTGTGACCTCGTGGAGACTGACATCTTGGAGTCGTTGGAAGATCTAGGTTACAAGGGTCCATTGTTAGAAGATGGCGCTCTGTCTCAGGCAGTCTCTGCTGGAGCCAGTTCCCCTGAGTTTACCAAACTCTGTGCTTGGCTGGTGTCTGAATTAAGAGTGCTCTGTAAACTGGAGGAAAATGTGCAAGCAACTAACAGCCCAGGTGAAGCTGAAGAATTCCAGCTTGAGGTGAGTGGGCTACTAGGGGAGATGAACTGTCCCTATCTTTCACTGACATCTGGGGATGTGACCAAGCGCCTTCTCGTTCAGAAGAACTGCCTCCTTTTGCTCACATACCTCATCTCAGAACTAGAAGCTGCCAGAATGCTCTGTGTGAATACTCCTCCAAAAAAAGCTCAAGAAGGAGGCGGTAGTGAGGTCTTTCAAGAGTTGAAAGGCATATGTATTGCTCTAGGAATGTCCAAACCTCCAGCCAATATAACTATGTTCCAATTCTTCAGCGGGATTGAAAAAAAATTAAAGGAAACATTAGCAAAAGTTCCACCTAATCATGTGGGAAAGCCTTTATTGAAGAAGTCAATGGGACCAGCCCACTGGGAAAAAATAGAAGCAATTAACCAAGCCATAGCCAATGAATATGAAGTTCGGAGAAAGCTGCTAATAAAACGTTTGGACGTCACTGTCCAATCTTTTGGTTGGTCTGACAGAGCTAAGAGTCAGACAGAGAAATTAGCAAAGGTTTACCAGCCAAAACGTTCACTCTTATCTCCTAAAAGTACTATTTCTGTTGCCCACCTTTTGGCTGCAAGACAAGACTTGTCAAAGATTTTAAGGACAAGCAGTGGCTCTGTAAGAGAAAAGACCGCCTGTTCCATCAATAAGGTGCTGATGGGCAGGGTACCTGACAGAGGAGGTAGACCCAACGAAATTGAACCACCGCCCCCAGAGATGCCACCATGGCAGAAAAGGCAAGATGGACCCCAGCAGCAAACAGGAGGCCGAGGAGGAGGGCGAGGTGGTTATGAACAGTCCTCATATGGAGGACGAGGAGGTCATGAACAAGGAGGAGGGAGAGGTG