Transcript asmbl_24446

Sequence
Transcript Sequence for observation asmbl_24446 of TGE0004210:
GGGACTTCCGGTCCGGGGGAAGCCGTGCGAGAACCGTCACGTTAGAGCCCGGTTTCTTCTTGGCGGACAGAAATGGACTCAGAAATCAAGGAGGAAATTCCCGTGCATGACGAATACGTTTTATGTGGCGGAGCTGAAACCTGCGTTCTGAAGTGTGGGCCCTGGACTGACCTGTTTAATGATCAGAGCGCCAGCAGACCTAAGCTGCTCATTTTCATTATTCCTGGTAACCCAGGTTTGCCTGCCTTTTATGTACCATTTGCAAAGGCTTTGTACTCTTCAGTAAACAGACGCTTTCCAGTGTGGGTTATCAGTCATGCTGGGCATGTTTTGGCTCCCCAAGACAAGAAGATTCTTACAACCTCGGATGATCCAAATGCTCAAGAAATTAAGGACATCTACGGACTCCGTGGTCAAATAGAACACAAGATAACTTTCCTGAGAACTCATGTGCCAAAGGAAACGAAACTGGTGGTCATTGGCCATTCAGTAGGCTCCTATATTTCCCTTCAGATTTTGAAGCATGCCCCCGAGCTCCCAATAATTCGCTCCTTCCTGCTCTTTCCAACAATTGAGAGACTATCTGAGTCACCCAACGGCAGAATCGCCACTCCGTTATTATGCTGGTTTCGATATGTTTTAAATGTTTTTAGCTACTTGTTATTTAAACCATGTCCGGAGAAAATCAAGTCCTGGTTGCTCAGGACGAGCTGTCAGATAATGAACCTGCAGGATGAATGTTCAGTCCAGAATGTGTTGGAACCTTTCTGCCTTGTTAATATTGCCTATCTCGGTGGCCAAGAAATGATGGAGATAGTAAAGAGAGACAACGAAACCATAAAGGAACATTTGTCTAAGCTTACATTCTACTATGGTGCTAAAGATGCTTGGTGTCCAAAAGAGTACTATGAAGACATAAAGAAAGACTTCCCAGAAGGAGATATTCGACTCTGTGAGAAAAAAATACCTCATGCTTTTATCTTATACTCTTACCAAGAAATGGCCGACATGGTGGCAGACTGGCTTAAGGACGATCTGTCCAAAATTGAAACGGTGACAGAAGAAAACCAGGACTGATAGCTGGCACGTAGAGGCGATAAGTATACTGCCTCTTTGTAGCAAGTAGTGCACTTAGTAGGTAAATGTTTAATTTTGATGTTTAATAATCGGAGAGAAAAAAAGTGAGAACCTCTCGGCTTACAGTCTGCCCACTCCCAGTTCCCCGTGCTACAGTCTGTGGTAAACACGGTTGATGGAATATTCCATAAATTTAACCTCACCTTTTCCAGGACTCACAACATGGAGATCTAGATAGGTCTCTTCCGTTTGCACGAGACGCCCAGTGGCACAGCTTATTTTGGTAGGCAGGATCGTTGCAGACAAAAGGAAGTCTAAATTTAGTTTATTTTAACTGATTTACCTTATAGAATGGCTTCTCCTAGAGGAAATTATTAAATAACTACTAGAAAATGTAAAAGAGATCAGTGAATGTTAAGTGTATAATCAGATATGTGAAGTGTATGAGATCGTGAGAAGGACATACTCATGTACCAACAGCAGGAAGTGATGAGCCATGGATCTTGGCAGCGGACCTGGGTCTCTCTTAAGGACAGAAGTTGAAGATTAGCCCAGACTAACTTCGTAAAGGCCTTGCCTGAGATCATCAGAATCAGGCTGAATACCAGGGCAGCCTGCGCCCACCTGTTCCTACCTTGCAGTACGTCGCAGACCACCAAGTCGGCCTTTTGTCTGAACACCAGTGGCACGAGCCCAAGGAGAGCCAACATTGGGGGAGGTGCTGCTCATCCTCACCTCTGAGAAGCATCCCTGAGGAGTGTGACTCCCTCATCCACCTGCCTTAGACAGGGAATGAGGTTTGACAGCCTTTGCCCTAGTCAACTAACCAGAGAAGAGTCGTTCAAGGATCCTGACTCTGCCTCCCCACCACAAGGCAGCCAGCCAACTCTGTGCCGAGCCTTAGTCTGCCGGACTGTGAGCTCCCTGCATGCTCCTCTTCTCCAGAGCCAGATGCGGAGTCCCTGGACTGTCCCAAATCAATCCTGTATGTACCCACCACATGCAGTTCCTCTTCTGTGATTTTTTCAGTGAAACTCCACTGAGGACCAGCAATGAGCCAAGTACTGTGCTGTGCATTGTGTATAGAGTTCTTAGCTATATTATGGTTCTTTTCTTCTGAAAATCTTCTAGTAAGTAATTTCCAAAAGGGCATCTTTAAATGAGGATTACCATAAATGAGTTCTCCATTTCTGCATTAGCTGTGTTAGTTGGAAATAAATCGTTTTACTAATGAACCAAAACAAATCATTAAATTATGTAAATTCACCTTCTCTGGAAACCTTGAGGTCCAATAGAGAAGAAGCTTGCTCTCTGGCCCAGAGTAGGCTAACAATTTTGCTGCCTTCCCCGAATTGACTCAATCCTGAGGCCTTAGGAGCCAATAAATCCCACTGACTACAGTGATGGTTGACCATGGACCAGAAACATTGGGGTTTTGAAATCCCTCAAACATTATCATTCTTTAAGGACAAGAGGATGTTGGCCTTCCTCTCAAAACCTGAAGCCCCCTGATGAAAGATTCAGGTCTGATATGCTGCCCACACCGCAGTGAGTGTTGAACGAGTTACTCTCTGTCAGGGCCTCCCCATCAGAGCAAGCAACTCCTCGGAGGGGAAGGTCCACGCTCCAGGCATGGAGTATTCTTGGCCGTGGAGAGGAGCCAGGACACTCAGAGGCCATTGGCTCAGGGCTGCACACAAAGTCCTTGTTGGCATCTGTGTGGAAGGTCTAGAAATCTGACGTTAGAGGCTAGAGCTCATGGACACCTCACTGTCCTCACTTATAGGATTAATAATGATAATGCATTAATAATAATGCATACCTCATATTGCTGGAAGAATTAAAGTAGATGATAAAATTAAAGCATTTAGCACAATGCCTGACCAAGAGTATCTTCTGAATAAAGACTGGCTGTAATAATAATTATTATTAAATATCACAGTAATAAAAATGAAAGACTAAGATTTATCAGCAGTGGATGAAATCCATTTTCCAGAAGCATCTCTGCCGGTATGTTCCAGTTAGCCCCATGGCTGGTCCTCGGCAGTAATTTCATACGGAGTTGTCTTCTTCTGTTCTCAGTCTGCTTCGCGCCGTGGGAGAAGATCTCCAGAGACAGGCCCCTGCGCTCGGGCTGATACCCAAGGCAGGCAGGGCCCTCTCTCCGTCTGCTTCTCTCGACCCTTGGAGAGCCAGTGACCTCCAGAGGCTTGATTTTTCTTCACCTTACATTATACATAAGATTAAATTTAATTCCAGATTAAGGGAGACTACAAAGACATGACCACATAATGCAACACCTGATTCTGGATTAGGTGTTTTTGTTACAAAAAGCATTGTTGGGACAATTCGCACGATTTGAATAGGGTCTGAAGTTCAGCTGGGAGTAAGAGATGTTAATTTTCTGATTTCAACGGTAGCGTTGTGGGGGAATAGGGGAATGTTTCTATTTGTAATGACATGCCTGGGGCGATGGGGCAGCTTGTCACTTTACTCTCAAATGGTTCA