Transcript asmbl_2421

Sequence
Transcript Sequence for observation asmbl_2421 of TGE0015007:
GTCGTGGGGCGTGCCCGGCCTTCCCCAACGCCCGGCAATCCCCGCCGTCGCCGCTGCCGCCTCGGCCCCTGCCGGGGCTTCCCGCAGCCGCCATGTCCGCCAGTGCCGTCTACGTGCTGGACCTGAAGGGCAAGGTGCTCATCTGCCGGAACTACCGCGGTGATGTGGACATGTCAGAAGTGGAACACTTCATGCCCATCCTGATGGAGAAGGAGGAGGAGGGGATGCTGTCGCCCATCCTGGCCCATGGCGGGGTCCGCTTTATGTGGATCAAGCACAACAACCTGTATCTGGTCGCCACCTCCAAGAAGAACGCGTGCGTGTCACTGGTGTTCTCCTTCCTCTATAAGGTGGTGCAGGTATTTTCAGAGTACTTCAAGGAGCTGGAGGAGGAGAGCATCCGCGACAACTTTGTCATCATCTATGAGCTGCTGGATGAGCTCATGGACTTCGGCTACCCCCAGACCACAGACAGCAAGATTCTACAGGAGTACATCACTCAGGAAGGCCACAAACTGGAAACGGGGGCCCCGCGGCCCCCAGCCACTGTCACCAACGCAGTGTCCTGGCGGTCCGAAGGCATCAAGTACCGGAAGAACGAGGTGTTCTTGGATGTCATCGAGTCAGTCAACCTCTTGGTCAGCGCCAATGGCAACGTCCTGCGCAGTGAGATTGTGGGCTCCATCAAGATGCGGGTCTTCCTCTCTGGCATGCCCGAGCTGCGCCTGGGCCTCAACGATAAGGTCCTCTTCGACAACACGGGCCGAGGCAAAAGCAAGTCAGTGGAGCTGGAGGATGTGAAGTTCCACCAGTGCGTGCGGCTGTCCCGCTTCGAGAACGACCGCACCATCTCCTTCATCCCCCCCGACGGCGAGTTCGAGCTCATGTCCTACCGTCTCAACACCCACGTCAAGCCCTTGATATGGATCGAGTCGGTGATTGAAAAGCATTCCCACAGCCGCATCGAGTACATGATCAAGGCCAAGAGCCAGTTCAAGCGGCGGTCAACGGCCAACAACGTGGAGATCCACATCCCTGTGCCCAATGACGCCGACTCGCCCAAGTTCAAGACAACAGTGGGGAGCGTCAAGTGGGTCCCTGAAAACAGCGAGATCGTGTGGTCCATCAAGTCTTTCCCGGGCGGCAAGGAGTACCTGATGCGGGCCCACTTTGGCCTGCCCAGCGTGGAGGCTGAGGACAAGGAGGGCAAGCCCCCTATCAGCGTCAAATTCGAGATCCCCTACTTCACTACCTCTGGCATTCAGGTACGCTACCTGAAGATCATCGAGAAGAGTGGCTACCAGGCCCTGCCCTGGGTCCGTTACATCACTCAGAACGGAGATTACCAGCTCCGGACCCAGTGAGGGGACAGTACCCCAGCTCTGGCATGGGGGCTCCTGGTGGAAGCACTGGGAGGAAGGCCTGCCAAGCCCACCGGAAGGAGGAGGGCACCCCGACACCAGCCACCCTCCCAGCCCTGCTGGGAGACTCCTCCTCCAGGCACACCTGTTCTTTCATCACCACTTGTCGCCAAAGCCCCTTCTCCCAGAAGAGGCTCGTCTTCCAGATGTCCTGTCTCTGCCCCGAGTCAGTCTGGGGAAAAGGAAGTAGAATCTTTCCCCCAGTGGTCACGTGCAGCCTCTGGGCTGTTTACCTCCCAGGCACCAAAAAAGGTCGGGAGACACTTGCCAGGCTGCAGCAGGGCCGCCGCCCCGTTCTGCTGACCGTTTATGAAGCTCCGGGGTTTCATCTTCTTTCATTGCTGTTTGTGTGAACCTCACTGTCTGCGCCTCCTGCCCCTCATCTTGAAGCTTTCGGGCAGCACTTAGGACAGGGTACCCCCTGTTCCTTGACCTCCTCCCACAGTGTGTTGCTCTCCACATGGGGCCAAAACCCAGCACTTTGGCCCCTTGAGGGCTCCTGGCCTGGACCCATAGGCTTTGACAAGGCACATCCCCAGGGCCAGCCTGTGCCACGTGATGTTGTCACGCAGCCACATCTGATGAGGTGGGTGTAGTGAGGGCCGCTGGCCTTGGAGGGTGGGGGGCATGGGTCATCCGCATCTGTGCTTGGTTACCCCCATCTGTGTTCATGTCACG