Transcript asmbl_15584

Sequence
Transcript Sequence for observation asmbl_15584 of TGE0003825:
GCACTTCTGCTGAGGAGCTGTCCCCAATTCATTTCTTGTTCCTGTCCCAGGAACGCTCTGCCACCACTTGCTTCATCTCTGGCTCATGAAGCAGTTTCCCAGCTGCTACAGACAGACCTTTCTGAGTTCAGGAAGCTGCCCAGGCAGGAGGTGGAGGACAACGAGGAAGAGGAGGAGAAGACCCCCGTGACCCTGCTGGATGCCAAGGGCCTGGCGCGGAGCTTCTTTAACCAGCTCTGGGAAGTGTGCAGCCAGTGGCAGAAGCAGGTGCCCTTGGCTGCCCGAGTGCCACAGCGGCAGTGGCTGGTCTCCATCCACGCCATCCGGAACACTCGCCGCAAGATGGAGGACCGGCACGTGTGCCTTCCCACCTTCAACCAGCTCTTCGGCTTGTCCGACCCTGTGGACCGCGCCTACTTTGCCGTGTTTGACGGTCATGGAGGTGTGGACGCTGCGAGGTATGCCGCTGTGCACGTACACGCCAACACTGCCCGCCAGCCAGAGCTGCCCACAGACCCCGCGGGAGCCCTCAGAGAAGCCTTCCGGCGCACCGATGAGATGTTCCTCTGGAAAGCCAAGCGAGAGCGGCTGCAGAGTGGCAGCACAGGTGTGTGCGCACTCATCG