Transcript asmbl_23530

Sequence
Transcript Sequence for observation asmbl_23530 of TGE0004164:
GGGTGAGGTGGCTTTGAACCCGGGTTGCCCGGCCAGCGCGACCAAGGAGGTGGCTGGAGGACTGGAGAATGAACGGAGAAGCCGACTGTCCCACAGACCTGGAAATGGCCGCCCCCAAAGGCCAAGACCGCTGGTCCCAGGAAGACATGCTGACTTTGCTAGAATGCATGAAGAACAACCTTCCATCCAATGACAGCTCCAAGTTCAAAACCACTGAGTCACATATGGACTGGGAAAAAGTAGCATTTAAAGACTTTTCTGGAGACATGTGCAAGCTCAAATGGGTAGAGATTTCTAATGAGGTAAGGAAGTTCCGTACATTGACAGAATTGATCCTTGATGCTCAGGAACATGTTAAAAATCCTTACAAAGGCAAAAAACTCAAGAAACACCCGGACTTCCCAAAGAAGCCCCTGACCCCTTATTTCCGCTTCTTCATGGAGAAGCGGGCCAAGTATGCTAAACTCCACCCTGAGATGAGCAACCTGGACCTGACCAAGATCCTGTCCAAGAAATACAAGGAGCTGCCGGAGAAGAAGAAGATGAAATATATTCAGGACTTCCAGAGGGAGAAACAGGAGTTCGAGCGAAACCTGGCCCGATTCAGGGAGGATCACCCTGACCTAATCCAGAATGCCAAGAAGTCGGACATCCCCGAGAAGCCCAAAACCCCCCAGCAGCTGTGGTATACCCACGAGAAGAAAGTGTATCTCAAAGTGCGGCCAGATGCCACTACGAAGGAGGTGAAGGACTCCCTGGGGAAGCAGTGGTCTCAGCTCTCGGACAAAAAGAGGCTGAAATGGATTCATAAGGCCCTGGAGCAGCGGAAGGAGTACGAGGAGATTATGCGTGACTATATCCAGAAGCACCCTGAGCTGAACATCAGTGAGGAGGGCATCACCAAGTCCACCCTCACCAAGGCCGAACGCCAGCTCAAGGACAAGTTTGATGGGCGACCCACCAAGCCACCTCCGAACAGCTACTCGCTGTACTGTGCAGAGCTGATGGCCAACATGAAGGATGTGCCCAGCACAGAGCGCATGGTGCTATGCAGCCAGCAGTGGAAGCTGCTCTCCCAGAAGGAGAAGGATGCCTACCACAAGAAGTGTGACCAGAAAAAGAAGGATTATGAGGTGGAACTGCTCCGTTTTCTGGAGAGCCTGCCTGAGGAGGAGCAGCAGCGGGTGTTGGGAGAGGAGAAGATGCTGAACATCAATAAGAAGCAAGCAACCAGCCCAGCCTCCAAGAAGCCCTCCCAGGAAGGGGGCAAGGGTGGCTCAGAGAAGCCCAAGAGGCCCGTGTCGGCCATGTTTATCTTCTCTGAGGAGAAGCGGCGGCAGCTGCAAGAGGAACGGCCAGAGCTCTCAGAGAGCGAGCTGACCCGCCTGCTGGCCCGCATGTGGAACGACTTATCGGAGAAAAAGAAGGCCAAATACAAGGCTCGGGAGGCTGCGCTGAAGGCCCAGTCGGAAAGGAAGCCTGGCGGAGAGCGCGAGGAACGGGGCAAACTGCCCGAGTCACCCAAGAGAGCAGAGGAGATCTGGCAACAGAGTGTCATTGGCGACTACCTGGCTCGCTTCAAGAATGACCGGGTGAAGGCCTTGAAAGCCATGGAGATGACCTGGAACAACATGGAGAAGAAGGAGAAACTGATGTGGATTAAGAAGGCGGCAGAAGACCAAAAGCGATATGAGAGAGAGCTGAGTGAGATGCGGGCACCTCCGGCTGCTGCAAACTCATCCAAGAAGATGAAGTTCCAGGGAGAACCCAAGAAGCCTCCCATGAACGGTTACCAGAAGTTCTCCCAGGAGCTGCTGTCCAACGGGGAGCTGAACCACCTGCCGCTGAAGGAACGCATGGTAGAGATTGGCAGCCGCTGGCAGCGCATCTCTCAGAGCCAGAAAGAGCACTACAAAAAGTTGGCAGAGGAGCAGCAAAAGCAATACAAAGTGCACCTCGACCTCTGGGTCAAGAGTCTGTCTCCCCAGGACCGAGCAGCATATAAAGAATATATCTCCAATAAACGTAAGAGCATGACTAAGCTGCGAGGCCCAAACCCCAAGTCCAGCCGGACTACCCTGCAGTCCAAGTCGGAGTCTGAGGAGGAGGATGACGAGGATGAGGATGATGATGACGAGGATGAAGAGGAAGAAGATGATGAGAATGGAGACTCCTCTGAGGATGGCGGGGACTCCTCTGAGTCTAGCAGCGAGGATGAGAGCGAGGACGGGGATGAGAATGAGGATGACGATGAGGATGATGATGAGGATGATGATGAGGATGAGGATGAAGACAATGAGTCCGAGGCCAGCAGCTCCAGCTCTTCCTCCTCAGGGGACTCCTCAGACTCTGACTCCAACTGAGGCTGGGCCCCACCCGGGGCTCCCCTCCCCAACTGACCACCTTTGTTTCTCCCCCTTGTTCTGTCCCCTGCCCATGACCCACCCACCCCACTCCCCA