Transcript asmbl_23497

Sequence
Transcript Sequence for observation asmbl_23497 of TGE0026836:
GTCGCAGGGCCCAACATCTGTACCACACGCGGTGTGAGCTCCTGCCAGCAGTGCCTGGCCGTGAGTCCCATGTGTGCCTGGTGCTCAGATGAGGCCCTGCCTCTGGGCTCTCCCCGCTGCAACCTGAAGGAGAATCTGCTGACGGATAACTGTGCCCTGGAGTCCATCGAGTTCCCCATCAGTGAGGCCAGCATCCTGGAGGCCAGACCCCTCAGTGACAAGGGCTCTGGAGACAGCTCTCAGATTACTCAAGTCAGTCCCCAGAGGATTGCGCTCCGGCTCCGGCCAGATGATTCGAAGAGTTTCTCCGTCCAGGTCCGGCAGGTGGAGGATTACCCTGTGGATATCTACTACTTGATGGACCTGTCTTACTCCATGAAAGATGACCTGTGGAGCATCCAGAACCTGGGTACCAAGCTGGCTTCCCAGATGCGCAAGCTCACCAGTAACTTACGGATTGGCTTTGGGGCCTTTGTGGACAAACCCGTGTCACCATACATGTACATCTCCCCACCAGAGGCCCTCAAAAACCCCTGCTATGATATGAAGACCACCTGTTTGCCCATGTTCGGCTACAAACATGTGCTCACACTGACTGACCAGGTGACCCGCTTCAATGAGGAGGTGAAGAAGCAGAGTGTGTCACGGAACCGAGATGGCCCAGAGGGCGGCTTTGATGCCATCATGCAGGCGACAGTCTGTGATGAGAAGATTGGCTGGAGGAATGATGCATCCCACTTGCTGGTGTTTACCACTGATGCCAAGACCCATATAGCACTGGATGGAAGGTTGGCAGGCATTGTCCAGCCCAATGATGGGCAGTGTCACGTTGGCAGTGACAACCATTACTCTGCCTCTACTACCATGGATTATCCCTCTCTGGGGCTGATGACTGAGAAGTTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAGAAGTAGTCAATCTCTACCAGAACTACAGTGAGCTCATCCCAGGGACCACAGTGGGAGTTCTGTCCACCGATTCCAGCAATGTCCTACAGCTCATTGTTGATGCTTATGGGGGGCTGGGCGATGTTCAACACTGGGAGCAACGCAGTCTTCTGAGAAAGAAATGGCTCAAAAAGGAATGCCAGGCCATGTTAGAAACAATGTGCGAAGAGCTTGGAGGNNNNNNN