Transcript asmbl_22568

Sequence
Transcript Sequence for observation asmbl_22568 of TGE0004130:
CTGAAGCCGGGCCCCCTGGAGGAGACCTACATCGCCACCATCCTGCGGGAGATTCTCAAGGGCCTGGACTACCTGCACTCAGAGCGAAAGATCCACCGAGACATCAAAGGTCCCCGGGCTCGCCTCCTCTCCTGGCCCTCGAGCCCGCCAACCCTGGACAGGCCAGGGTGTGAGGTGGCAGGCGGCTGTGCGGGGCACGCGGCTGGTGGGGCTGGGGGCCTCGCAGCTCCGCGCTCCTGGCCTTTATCCCCTGCGGCCACCGGACACTGATGGCAGAGACGCTGGCGCCACGCCCTCATGCACCGGGAATGCCAGCCGTCTCCTGCTGGGAGAGCCACCGCACTGTGGGTTGGCCCTGCCGAGTCCCTGGGGAGGGGTCAGGGCCACCTGCATGCTGGCGTGGAAGGCAGGCCCGGGGAGGGCCCCTCACGCTTGCGGGCGCCCCCGGCAGTGCCCTGGCCTGGGCCTGTCTCTGGGCCGTGGGGGGAGGCAAAGCTGAGTGAGGCTCCACCAGCAGGTGCTGCTTCAGGCAGCTGCTCGCGGTGGGGTCTCCCTGGCTCAGAGCATGATGCCTCGCTGTCCTGTATCAAGCAGCTGCCAATGTGCTGCTCTCGGAGCAAGGCGACGTGAAGCTGGCGGACTTCGGGGTGGCAGGGCAGCTCACGGACACGCATATCAAGAGGAACACGTTCGTGGGCACCCCGTTTTGGATGGCGCCCGAGGTCATCAAGCAGTCAGCCTACGACTTCAAGGCTGACATCTGGTCACTGGGGATCACGGCCATTGAACTGGCCAAAGGTGAGCCTCCGAACTCTGACCTCCACCCCATGCGCGTCCTGTTCCTGATCCCCAAGAACAGCCCGCCCGTGCTAGAGGGCCACCACAGCAAGCCCTTCAAGGAGTTTGTGGAGGCCTGCCTCAACAAGGACCCCCGATTCCGGCCCACGGCCAGAGAGCTCCTGAAGCACAAGTTCATCACGCGCTACACCAAGAAGACGTCCTTCCTCACCGAGCTCATCGACCGCTACAAGCGCTGGAAGTCTGAGGGCCACGGCGAGGAGTCCAGCTCAGAGGACTCTGACATTGATGGGGATGCTGAGGATGGGGAGCAGGGCCCCATCTGGACGTTCCCCCCCACCATCCGGCCAAGCCCGCACAGCAAGCTGCACAAGGGGTCAGCGCTGCACGGCCCCCAGAAGTCTGCTGAGCCTGCCAAGAGGCAGCCGAGGTCCCAGTGCCTGTCCACGCTGGTCCGGCCTGTCTTCGGAGAGCTCAGAGAGAAGCACCGGCAGAGCGGTGGGGGCGTGGGGGCGCTGGAGGAGCTGGAGAACGCCTTCAGCCTGGCCGAGGAGTCCTGCCCCGGCATCTCGGACCAGCTGATGGCCCACTTGGTGGAGCGGGTGCAGCGGTTTTCACACAACAGAAACCACCTGACGTCCAGCCGCTGAAGCCGCCGTGGACGGGGAGCGGGCAGGGTGGCCTTCGTTTTGAGCTCTGTAGGGTCCTCGCTGACTTGGAGCCCTTTGCACCGTGTCACGGCCTCACCGCTGGGTCTCAGCCCCTACCCTGTGCGGAGGGCTGTCCCCCGTCCCTTCCTGGCTGGGCTGAGGTTACAGCTGGCAGCAGAGACCCCCTGGAGAACCAAGTGACCCTGTGGGGGCAGCGGGCTCGGTCCCCTCAGGCCTCCTTGGCAGGGCCGTCCCCTCCCCCAGGCTCACTGGGTGCAGCTGCTTGGATGGGGGTGTGGAGCCTGTCAGCCCAGCCCTTCCCTTGCCCAGGGCCATAGTGGCCGTGGATTTGCCTTGTGGTGTGAGACCAGGTGCCGTGTCTTCTCGTAAGCGCACGCGTCAGCCAGAACATTTTGTATTTTAAGAAAACTGAACTCTGCTTTCCTGTATCTTCCGAAGTTAAGGTGTTGGTCTCACGGGACGTGGAGAGGCTCCTGCCCCTTTCAATAAACACCTGAATTG