Transcript asmbl_22533

Sequence
Transcript Sequence for observation asmbl_22533 of TGE0011859:
CTGGCACGTGACTCCTTTCCCCATTCAGATCCCATGTCTGTGGGATGACGGCTCACTGCTCACTCTGGTGCTTTGCCTAACGCCTTCTCAGACGGAGCTGTCCTGTGCTCCTTGCTGTCCTCTGCCGTCTCCTCTCCACTGCTCAGCGCTGCGGAGACTGGCCCCGGCCGGCACTGGTCCGACCTCCATTGCAGACTGCCCCGGGGGAGAGGCCTCGAGGGGTGTGGCTTATCTGCGTGCCCCGTTAGGACATTGCTGACCGTTCCCTCGCATTTGCTCTGGGATTAGGGCTTCTGGAGGGAAGGGCACAGTTTTGTATTGGCTTTGTGTTCTCTTTTCTCAGCCTCTTCAGTGATCTTCAGTTTGAAAGGCTACGTGGCCGAGCGGAAGGGCGAGCGGGAGGAGATGCAGGACGCCCACGTCATCCTGAATGACATCACCGAGGAGTGCGGGCCCCCGTCATCCCTCATTACCCGGGTTTCTTATTTTGCTGTTTTCGATGGACATGGAGGAATTAGAGCCTCAAAATTTGCTGCACAGAATTTGCATCAGAACTTAATCAGGAAATTTCCTAAAGGGGATGTAATCAGTGTAGAGAAAACCGTGAAGAGATGCCTTTTGGACACTTTTAAGCATACCGATGAAGAGTTCCTTAAACAAGCCTCAAGCCAGAAGCCTGCCTGGAAAGATGGGTCCACTGCCACGTGTGTTCTGGCTGTAGACAACACTCTTTATATTGCCAACCTCGGAGATAGCCGGGCCATCCTGTGTCGCTACAACGAGGAGAGCCAGAAGCATGCCGCCTTAAGCCTCAGCAAGGAGCACAATCCTACACAGTATGAGGAACGGATGAGAATACAGAAGGCTGGAGGGAATGTCAGGTAACGGCCGCCAGGGGTGGGGCGCTCGCCGTGAAAGCGGCCGTGAGACTTCCG