Transcript asmbl_22112

Sequence
Transcript Sequence for observation asmbl_22112 of TGE0004100:
CGGGCCTAGGCGCGAGCCCGGAGCGCTGAATCCGCGCTTCGGCCCCGGAGCCGCGGTCTCCCGCCATGGGTCTCTGTCTCTTCCTCTACCGCGCACCCCTGCTTCTGTGGGGCCTACTGTTTCTCCTGCTGCTTGCAGTCTCGGCTCTCCAGGCTGGACGTCCGTCCCCTGTGGTCCTGGTGCCTGGTGATTTGGGCAACCAGCTGGAGGCAAAGCTGGACAAGCCAAAGGTCGTGCACTACCTCTGCTCCAAGAAAACAGACAGCTACTTCACACTCTGGCTGAACCTTGAACTGCTGCTGCCTGTCATCATTGACTGCTGGATCGACAATATCAGGCTGGTGTACAATAGAACGTCCCGGACCACCCAGTTTCCTGATGGTGTGGATATGCATGTCCCTGGCTTTGGGAAGACCTTTGCACTGGAGTTTCTGGACCCCAGCAAAAGCAGTGTGGGTTCCTATTTCCACACTATGGTGGAGAGCCTTGTGGGCTGGGGCTACACACGGGGTAAGGATGTCCGGGGGGCCCCCTATGACTGGCGCCGAGCCCCAAATGAAAACGGGCCCTACTTCCTGGCCCTCCGGGAGATGATCGAGGAGATGCATCAGCTGTATGGGGGCCCCGTGGTGCTGGTTGCCCACAGTATGGGCAACATGTACACGCTCTACTTTCTGCAGCGGCAGCCACAGGCCTGGAAGGACAAGTACATCCGTGCCTTCTTGGCACTGGGTGCGCCTTGGGGGGGCGTGGCCAAGACCCTACGCGTTCTGGCCTCAGGAGACAACAATCGGATCCCGGTCATTAGTCCCCTGAAGATCCGGGAGCAGCAGCGATCTGCTGTCTCTACCAGCTGGCTCCTGCCCTATAACTATACCTGGTCACCTGAGAAGGTCTTCGTGCGCACACCCACGGCCAACTACACGCTGCGCGACTATCACCGGTTCTTCCAGGACATTGGCTTTGAAGATGGCTGGCTCATGCGGCAGGACACGGAAGGGCTGGTAGATGTCACAATGCCACCTGGCGTACAGCTGCACTGCCTCTATGGCACTGATGTCCCCACGCCGGACTCCTTCTACTATGAGAGCTTCCCGGACCGCGACCCTAAAATCTACTTTGGCGATGGTGATGGCACTGTGAACTTGCAGAGTGCCCTGCATTGCCAGACCTGGCGCAACCACCAGGCACACCAAGTATCATTGCAGGCGCTGCCAGGCAGTGAGCATATTGAAATGCTGGCCAATGCCACCACTCTGGCCTATCTGAAACGCATGCTCTTTGGGCCCTGATTCCTGTCCCAGCCAGGGCTGCGCGATGGCTCGGCTACAGCTGCTTCTCTTGGACTCTGGGGCTGCGATGGCCCATGAGTTTAGCAGTTTGTGACTGACCATCCAAGGTCCTGAGTCTTTGGTTGTGAAACATCTTCCATATGAAGTGCTGTTTCTTATCCTTTCTCTGGGAGGGAGGAAGGAAGAAATAGTCTAGACTCACTTGAGGGACCCTTAATGGAAAGAATGCTGCTGCTGATGGAATTGTGACCTCAGGACTGGCTCTGCAGGTGGATTGGCTGGCACCTGGATCCAATCCCCAACTCAGGGGCCATGTGTTCCTCCTATGCCTGTGGCCTTTTCACATTTACCCACCAGGCCTGGCCCCTCAGCCTTCCTGTAAGTGATATGACTAAGCTGTGGTTCCTACCCCCACAGGCCCCAGGAATGGGCTCCTGGTCCCTAGGGTGACCCTTCCCACACACTGGCCACAGGTGAGCCTACTACTGGCCATGGGTGGCTGGAGCTGCTGGCTTCCTTGTAGCATAGCTGCTTGACAGTCTGACTGGCTTTCTGAGGGCAGTCCAGTTTCCCCTGCAGGCAGGGGCAGATTGTTGTGTTCTCTGTGGTTCTCAGGCTCTGGGGCATTCACTCTTACCTCCCTCACCTCTAAAAACAGCCTAGCTCAGGATTGGGCAGCAGATGGCCCCTTAGTTCTGCAGCCATGGCCCAGGAGCTCTGATCCCCTTGGTCGGGCTGTTTCCCACAGTACTGATGTTAGCTTCCTTTACCTTGGGACTATGGTTCAAGGATAAGAGCAGGGCCCAGTGCCATGGCCTTTTAGGTCCTCATGAAGAAAGAAAACTTAAGGACACAGACAAGATGATTCGGAGTTTCTCTGAACTGCCCTCTTGCTAACTCTACCACCATACTGCCACCCTTCCCCACGGTTTCTCTAGTACCCAAGTGGGCTGGCACAGAGTCGAAAGGAGACAGGGCTTCTGCCCATCCTGCCCAGCACATACCTCCACCAGGCAGCTCAGTGGTGTTTAGTCTGCAGGGACAGCTCAGAACATACTTTGGGACCCTGTGAGACCCAGGTGCCTTGGAGCCCCCTTGGGGGTTTCTGTCTGCCTCAGAGGTGCTGCATGAGTCTCCTTGTGATAGCAGGGCTGGAGAATCTGGATTTACCTTGGTGGCAGTGGTCTCCAAGTAGGCGACAGCTATAAGCCAAGACTTGGGTCTAGCCTCTAGGGTGAGGCCCCAAAGCCACAGTCAGACTAGACTGTGCTGTTCTCCCACAAGATTTCTGTGGAGCCGGATTTTCTCTGTTGTGTACATACCCAGCATCTGTCTCTCCCTTTGTTTCTGAGTGGTGGGCCTCACCTGCATGGGGCTCTGAGCAGGCTGTACCTCGATT