Transcript asmbl_21919

Sequence
Transcript Sequence for observation asmbl_21919 of TGE0004071:
GCCGAGTCAGCTGGTTTTGGAATTGCGCTGCGTGCCTGCGGGTTGGGGTTCTCTGGTCCCGCCGGCCCCGCCGCAGCCATGTCGTTCTTCCCGGAGCTTTACTTCAACGTGGACAATGGCTACTTGGAGGGACTGGTGCGCGGCCTAAAGGCTGGTGTGCTCAGCCAAGCCGACTACCTCAATTTGGTGCAGTGCGAGACGCTCGAGGACCTGAAGCTGCACCTGCAGAGCACTGACTACGGTAACTTCCTTGCCAATGAGGCATCACCACTGACAGTGTCAGTCATCGATGACCGGCTCAAGGAGAAGATGGTGGTAGAGTTCCGCCACATGAGGAACCATGCCTACGAGCCACTCGCCAGCTTCCTGGACTTTATTACTTACAGCTACATGATTGACAACGTGATCCTACTCATCACGGGCACGCTGCACCAGCGCTCTATCGCCGAGCTTGTGCCCAAGTGCCACCCACTAGGCAGCTTTGAGCAGATGGAGGCCGTGAACATTGCGCAGACACCTGCTGAGCTCTACAATGCTATTCTGGTGGACACACCCCTGGCGGCTTTTTTCCAGGACTGCATCTCAGAGCAGGACCTCGATGAGATGAACATTGAGATCATCCGCAATACGCTCTACAAGGCCTACCTGGAATCCTTCTACAAGTTCTGCACCCTACTGGGCGGGACCACAGCTGATGCCATGTGCCCCATCCTGGAGTTTGAAGCAGACCGCCGCGCCTTCATCATCACCATCAACTCCTTTGGCACAGAACTGTCTAAAGAGGATCGTGCAAAGCTCTTTCCACACTGTGGGCGGCTCTACCCAGAGGGCCTGGCCCAGCTGGCTCGGGCTGATGACTACGAACAAGTCAAGAACGTGGCTGACTACTACCCGGTGAGTGCCCTGGCTACAGGACAGTGGGTGAGCGTATTGGCACCTACATACCCACACCCAACAATGCCCTTATGCTCATGCTTCCCACCACTCCCCTGGGCCAGGAGTATAAGCTGCTCTTTGAAGGAGCAGGGAGCAACCCCGGAGACAAGACCCTGGAGGACCGATTCTTTGAGCATGAGGTGAAACTGAACAAGTTGGCCTTCCTGAACCAGTTTCACTTTGGTGTCTTTTACGCCTTTGTGAAGCTCAAGGAGCAGGAGTGTCGCAACATTGTATGGATTGCCGAGTGCATTGCCCAGCGTCACCGCGCCAAGATCGACAACTATATCCCCATCTTCTAGTGCCCTGGCCCAAGGCTCCCCATAAGTGTGTGTGTGTCTGTGCTGTGACCGAGGCTCCAGCTCACCTGCCTGTTCTGGGGGTAGCACATTGTCTTAGTGGCTGCCCAGTTTCCCTGACACTCTGCTCTTGGGCCTGAAAAGAGGCTGAGTACCTGTTCTCCCCACCAAGGATGGATGGACCAAGGCCCCACCTCCAGATCAAGGAGGCCCCTCAGTCCTGTTTACAGCCACTGACATGTCTGAGAAGCATGTGGTCACTTTTGTGTCCTTCCCTAACCTGAGAATCACTGGGGGCAACATGAGCCTCCTCTCTCCTTTATGGGTCAACCCCAGAGACATGGCCCAGGGGAAGGATAGTGTGTGTCTTTGAGGCATGGGGGTGCATCCCCCTCCTTCAGCTCTGCCCTTCAACAATAAACTGCCCTCTCCAAA