Transcript asmbl_21889

Sequence
Transcript Sequence for observation asmbl_21889 of TGE0026778:
TGAGCGCGCGACCTCCGGCGCCATTTTGTAGAGAAACAAGCGGAGTTAACCGAAGAGGGGGGTCGAGGAGAGCCGGAGTCGGGGACCCAGGAGTTTCCTGTGTCCAGCGCCACCGGAACCGCCTGAGGTGCCATGTTTCAGAACAGAGTAAGACCCCTGGTAAAGAAGAACTGAAGACACTGTATAGACACCAGATATAGGCTAATTACAAAGAAAGCATTAACCTGCCTCTGAGGTGACTAAAGGGGAATAATGGTGATTTTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCTCGCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAGCCAGCCAGCAGGAAATACAGCATATTGTGAATCGGCACGGTCCTGAGGCAGACAGGCATTTATTACGCTGCCTATTTTCGCATGTGGATTTCAGTGGCGATGGTAAAAGCAGTGGCAAAGATTTTCATCAGACTCAGTTTCTGATTCAGGAGTGTGCGTCGCTGATTACAAAGCCAAATTTTATCTCCACGCTGTCCTATGCCATTGATAATCCATTGCACTATCAGAAGAGTTTAAAGCCTGCACCCCACTTATTTGCCCAGCTGAGTAAAGTTCTCAAGTTAAGCAAAGTACAAGAGGTAATTTTTGGCCTTGCCCTCTTGAATTCTTCCAGCTCAGATCTCAGAGGTTTTGCTGCCCAGTTTATCAAACAGAAGCTTCCAGATCTTCTGCGTTCTTACATTGACGCAGACGTCAGTGGAAATCAAGAAGGTGGCTTCCAAGATATAGCCATAGAGGTCCTACACCTCCTCCTCTCCCATCTCCTTTTTGGGCAGAAGGGAGCCTTTGGAGTTGGACAGGAGCAGATAGACGCTTTCCTTAAGACGCTGCGCAGAGATTTTCCCCAGGAACGCTGTCCTGTGGTGCTTGCACCACTTTTATACCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGCCTGATTCTGGAGGGGTAGCTAAAACCATGATGGAGAGCTCTTTGGCTGATTTTATGCAAGAAGTAGGCTATGGCTTTTGTGCAAGTATTGAAGAATGTCGCAATATAATCATGCAATTTGGTGTTCGGGAAGTCACAGCTGCCCAGGTTGCAAGGGTTTTGGGAATGATGGCTCGAACTCATTCAGGATTAACAGATGGAATTCCATTACAGAGTATCTCTGCTCCTGGCAGTGGGATCTGGAGTGATGGAAAAGATAAAAGTGATGGAGCACAGGCACACACGTGGAATGTAGAAGTCTTGATTGATGTTCTCAAAGAACTGAACCCGAGTTTGAATTTCAAGGAAGTAACTTATGAACTGGACCATCCTGGATTTCAAATTCGTGACAGTAAAGGACTTCATAATGTGGTTTATGGCATTCAAAGGGGTCTGGGAATGGAAGTGTTCCCAGTAGACCTCATATATAGACCTTGGAAACATGCAGAAGGCCAGCTCTCCTTCATTCAGCATTCCCTTATAAATCCAGAGATCTTCTGTTTTGCTGACTATCCCTGTCATACTGTTGCCACTGATATTCTGAAAGCACCACCAGAGGATGACAATCGAGAAATTGCCACATGGAAGAGCTTGGATTTGATTGAATCTCTACTGAGGCTCGCAGAGGTGGGGCAATATGAGCAAGTCAAACAGCTCTTCAGCTTTCCTATCAAACACTGTCCAGACATGTTGGTATTGGCCTTACTACAAATCAACACCTCCTGGCACACCTTGCGCCATGAGCTCATCTCCACTCTGATGCCAATTTTCCTCGGAAACCATCCTAACTCTGCTATTATTTTGCACTATGCATGGCATGGGCAGGGACAGTCTCCCTCAATCCGCCAGCTTATCATGCATGCAATGGCAGAGTGGTACATGCGAGGGGAGCAGTATGATCAGGCCAAATTGTCTCGAATACTTGATGTGGCCCAGGACTTGAAGGCCTTGTCAATGCTGCTAAATGGTACTCCATTTGCCTTTGTTATTGACCTTGCTGCACTTGCTTCACGTCGTGAATACCTCAAACTTGACAAGTGGCTCACAGATAAAATTCGAGAGCATGGAGAGCCTTTTATCCAGGCATGCATGACTTTTTTAAAGAGACGGTGCCCTTCTATTTTGGGTGGACTCGCCCCAGAGAAAGATCAGCCCAAAAGTGCTCAACTTCCTCCAGAAACTCTGGCGACAATGTTGGCCTGTTTACAAGCTTGTGCAGGGAGTGTTTCTCAGGAGTTATCAGAAACCATCCTCACCATGGTAGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAACCGCCACCTGGAGTTATGCCAAAAGGACGCCCTCCTAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCAGATTGACCCTCTAGCTGGAATGGCATCTCTTAGTATAGGTGGTTCAGCTGCCCCTCACACCCAGAGTATGCAGGGTTTTCCACCAAATTTGGGTTCTGCATTCAGTACCCCTCAGTCACCAGCAAAAGCATTTCCACCCCTTTCTACCCCAAATCAAACAACTGCATTCAGTGGTATTGGAGGACTTTCATCACAGCTCCCAGTAGGTGGTCTTGGCACAGGCAGCCTGACTGGTATAGGAACTGGGGCTCTTGGACTCCCTGCAGTGAATAACGATCCTTTTGTACAGAGGAAACTGGGCACCTCTGGACTGAACCAGCCTACATTCCAGCAGAGTAAGATGAAACCTTCGGACTTGTCTCAGGTGTGGCCAGAGGCAAACCAGCACTTTAGTAAAGAGATAGACGATGAAGCAAACAGCTATTTCCAGAGAATATATAATCACCCACCACATCCAACTATGTCTGTTGATGAGGTATTAGAAATGCTACAGAGGTTTAAAGACTCTACCATAAAGAGAGAACGAGAAGTATTTAATTGTATGCTAAGGAACTTGTTTGAAGAATATCGGTTTTTCCCCCAGTACCCTGATAAAGAGTTACATATAACAGCCTGCCTGTTTGGTGGGATAATTGAAAAAGGACTGGTCACTTACATGGCACTAGGTCTGGCCCTGCGATATGTTCTTGAAGCCTTACGCAAGCCTTTTGGATCCAAAATGTATTATTTCGGGATTGCTGCACTAGATAGATTTAAAAATAGATTGAAGGACTATCCCCAGTATTGTCAGCACTTGGCTTCTATCAGTCACTTTATGCAGTTTCCACATCATTTACAGGAGTATATTGAGTATGGACAGCAGTCTAGAGATCCTCCTGTGAAAATGCAGGGCTCCATCACAACACCCGGAAGTATTGCACTGGCTCAGGCTCAGGCTCAGGCCCAGGTTCCAGCAAAAGCACCCCTTGCTGGTCAGGTTAGCACTATGGTAACCACCTCAACAACCACCACTGTTGCTAAAACGGTTACAGTCACCAGGCCAACTGGAGTCAGCTTTAAGAAAGATGTGCCACCTTCTATTAATACTACAAATATAGATACATTGCTTGTGGCCACAGATCAAACTGAAAGAATTGTAGAGCCCCCAGAAAATATCCAGGAGAAAATTGCATTTATCTTCAACAATCTCTCACAGTCGAATATGACACAAAAGGTTGAAGAACTCAAGGAAACTGTGAAGGAAGAATTTATGCCTTGGGTTTCACAGTACCTGGTTATGAAGAGAGTCAGTATTGAGCCAAACTTTCACAGCTTGTATTCAAACTTCCTTGACACGCTGAAGAATCCTGAATTTAATAAGATGGTTCTAAATGAGACCTACAGAAACATCAAAGTTCTCCTGACCTCTGATAAAGCTGCAGCCAATTTCTCAGATCGTTCTTTGCTGAAGAACTTGGGACATTGGCTGGGAATGATTACACTAGCTAAAAATAAACCCATCTTACATACTGACTTGGATGTGAAATCTTTGCTGCTAGAGGCTTACGTTAAAGGACAGCAAGAATTGCTCTATGTAGTACCCTTTGTTGCCAAAGTCTTAGAGTCTAGCATTCGTAGTGTGGTTTTTAGGCCACCCAACCCCTGGACAATGGCAATTATGAATGTATTAGCTGAGCTACATCAGGAACATGACTTAAAGTTAAACTTGAAGTTTGAGATTGAGGTCCTCTGCAAGAACCTTGCATTAGACATCAATGAGCTAAAACCTGGAAACCTCCTAAAGGATAAAGATCGCCTAAAGAACTTAGATGAGCAACTCTCTGCTCCAAAGAAAGATGTCAAACAGCCAGAAGAACTCCCTCCCATCACAACCACAACAACTTCTACGACACCAGCTACCAGTACCACCTGTACAGCCACGGTTCCACCACAGCCACAGTACAGCTACCATGACATCAATGTCTATTCCCTCGCAGGCCTGGCACCACACATTACTCTAAACCCAACAATTCCCTTGTTTCAGGCCCATCCGCAGTTGAAGCAGTGTGTGCGTCAAGCAATTGAACGGGCTGTCCAGGAGTTGGTCCATCCTGTGGTGGATCGATCAATTAAGATTGCCATGACTACTTGTGAGCAAATAGTCAGGAAGGATTTTGCCCTGGATTCTGAGGAATCTCGAATGCGAATAGCAGCTCATCACATGATGCGTAACTTGACAGCTGGCATGGCTATGATTACTTGCAGGGAACCTTTGCTCATGAGCATATCTACAAATCTGAAAAACAGTTTTGCCTCAGCTCTTCGTACTGCATCCCCACAACAAAGGGAAATGATGGATCAGGCAGCTGCTCAGTTAGCTCAGGACAATTGTGAATTAGCCTGCTGTTTTATTCAGAAGACTGCAGTAGAAAAAGCAGGCCCTGAGATGGACAAGAGATTAGCAACTGAATTTGAGCTGAGAAAACATGCTAGGCAAGAAGGGCGCAGGTACTGTGATCCTGTTGTGTTAACATACCAAGCTGAGCGGATGCCAGAGCAAATCAGATTGAAAGTTGGTGGTGTGGACCCAAAGCAGCTGGCTGTTTATGAAGAATTTGCACGCAATGTGCCTGGCTTCTTGCCTACTAATGATTTAAGTCAGCCCACGGGATTTTTAGCTCAGCCTATGAAGCAAGCTTGGGCAACAGATGATGTAGCTCAAATTTATGATAAGTGCATTACAGAACTGGAGCAGCACCTACATGCCATCCCACCAACATTGGCCATGAACCCTCAAGCTCAGGCTCTGAGAAGTCTTTTGGAGGTTGTAGTTTTATCTCGAAACTCTCGGGATGCCATAGCTGCTCTTGGATTGCTCCAGAAGGCTGTAGAGGGCTTACTAGATGCCACAAGTGGTGCTGATGCTGATCTGCTGCTGCGCTATAGGGAATGCCACCTCTTGGTCTTAAAAGCTCTTCAAGATGGCCGTGCATATGGGTCTCCGTGGTGTAACAAACAGATCACAAGGTGCCTAATTGAATGTCGAGATGAATATAAATATAATGTGGAGGCAGTGGAGTTGCTAATTCGCAATCATTTGGTTAATATGCAGCAGTATGATCTTCACCTAGCTCAGTCAATGGAGAATGGTTTAAACTACATGGCTGTGGCATTTGCTATGCAATTGGTAAAAATCCTGCTGGTGGATGAAAGGAGTGTTGCCCATATTACTGAGGCAGATCTGTTCCACACCATTGAAACCCTCATGAGAATTAATGCTCACTCCAGAGGCAATGCTCCAGAAGGATTGCCCCAGCTGATGGAAGTAGTGCGATCCAACTATGAAGCAATGATTGATCGTGCTCATGGAGGCCCTAACTTTATGATGCATTCTGGGATTTCTCAAGCCTCAGAGTATGATGATCCTCCAGGCCTGAGGGAGAAAGCAGAGTACCTTCTGAGGGAATGGGTGAATCTCTACCATTCAGCAGCAGCTGGCCGTGACAGTACCAAAGCTTTCTCTGCGTTTGTTGGACAGGTAGAGCTTTTGGAAAGAAAGATGCACCAGCAAGGAATCCTGAAGACTGATGACCTCATAACAAGGTTTTTTCGTCTGTGTACTGAAATGTGTGTTGAAATCAGTTACCGTGCTCAGGCAGAGCAGCAGCACAATCCTGCTGCTAATCCCACCATGATCCGAGCCAAGTGCTATCACAACCTGGATGCCTTTGTTCGACTCATTGCACTGCTAGTGAAGCACTCAGGGGAGGCCACCAACACTGTCACAAAGATTAATCTGCTGAACAAGGTCCTTGGTATAGTAGTGGGAGTTCTCCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCTTCCCTACCATCGAATATTTATCATGCTGCTCTTGGAACTCAATGCACCTGAGCATGTACTAGAAACCATTAATTTCCAGACACTTACAGCTTTCTGCAATACATTCCACATCTTGAGGCCTACCAAAGCTCCAGGCTTTGTGTATGCCTGGCTCGAACTGATCTCCCATCGGATATTTATTGCAAGAATGCTGGCACATACGCCACAGCAGAAGGGATGGCCTATGTATGCACAGCTACTGATTGATTTATTCAAATATTTAGCACCTTTCCTTAGAAATGTGGAACTCACCAAACCTATGCAAATCCTCTACAAGGGCACTTTAAGAGTGCTGCTGGTTCTTTTGCATGATTTCCCTGAGTTCCTTTGTGATTACCATTATGGATTCTGTGATGTGATCCCACCTAATTGTATCCAGCTAAGAAATCTGATACTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTTACTCCCAATCTGAAGGTGGATATGTTGAGTGAAATTAATATTGCGCCCCGGATTCTCACCAATTTTACTGGAGTGATGCCACCTCAGTTCAAAAAGGATTTGGATTCCTATCTTAAAACTCGATCACCGGTCACTTTTCTATCTGATCTGCGCAGCAACTTACAGGTGTCCAATGAGCCTGGCAATCGCTACAACCTCCAGCTCATCAATGCACTGGTGCTCTATGTAGGGACTCAGGCCATTGCACACATCCACAACAAGGGCAGCACACCTTCAATGAGCACGATCACCCACTCGGCTCACATGGACATATTCCAGAACCTGGCTGTGGACTTGGACACTGAAGGCCGGTATCTCTTTTTGAATGCAATTGCAAATCAGCTGCGGTACCCAAATAGCCACACTCACTACTTCAGCTGCACCATGCTGTATCTCTTTGCAGAGGCCAACACTGAAGCTATCCAAGAACAGATCACAAGGGTTCTCTTGGAACGGTTGATTGTAAATAGGCCACATCCTTGGGGTCTTCTTATTACCTTCATTGAGCTGATTAAAAATCCAGCATTTAAGTTCTGGAACCACGAGTTTGTACACTGTGCCCCAGAAATTGAAAAGTAAGTTAAAATTTTTTAATTGTAGGAGAATGAGAATAATTTGAAGGGTCCA