Transcript asmbl_20927

Sequence
Transcript Sequence for observation asmbl_20927 of TGE0001383:
GCAGTGTAAAGGCCCTTCGGTCTAAGGCTTTCCTATTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAAGGGGACGGAGTAGGGGAAGACGTTTGCTCTCCCGGAACAGCTTATCTCATTCTTTTCCTTCGATTACCCGTGGCGCGGAGAATCAGGGCGGCGGCTGCAGCAGCAAGGGCGGCGGTGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGAGACTCTGGAGTTGGAAAGTCTTGCCTCCTTCTTAGATTTGCAGATGATACATATACAGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGATGGGAAAACAATCAAGCTTCAAATTTGGGACACAGCGGGCCAAGAAAGATTTCGAACAATCACCTCCAGTTATTACAGAGGAGCGCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAACGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAGTTGTTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCAAAGGAATTTGCTGATTCTCTTGGAATTCCATTTTTGGAAACCAGTGCTAAAAACGCAACGAATGTAGAACAATCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCTGGAGCAACAGCTGGTGGTGCAGAAAAGTCCAATGTTAAAATTCAGAGCACTCCGGTCAAGCAGTCAGGTGGAGGTTGCTGCTAAAATTTGCCTCCGTCCTTTTCTCACAGCAGTGAATTTGCAATCTGAACCCAAGTGAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTCTCCACAAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTATTCCCTTGACTCAAGACAGCTAACTTCATTTTCAGAACCGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGACTGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTCTATTGGCATGTTTAGATGTCAGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCAAACAGCACAACCATTGTCTGTCACTTTCCATGCATAAAGTTTAGTGAGATGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTTGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACGTATGGTGATAAGTATTTTAATTCTATGGTTAAAGGGAAATAGAGCCTTTCATTATTCTTAAAACAGCCATTTCTGTGTGCAACCAGGGCATTGTAGACCTATCTTAGAGCAGCATTCAATATGTTTTCCAGATAATATATCCAATATATGACCTAGGGAGGCTTCTGTGCTGGGTAGGGATTTAACCAAGCTTAGTGGTTCAGGGAGATTAAACTGTATGAAAAGCAAGTTTAGGATGTATGCTTTCTAGCGCATTATCTTTGCTCCCTTCTCTGAAACCATTGGAAATGGTTTATTTGATCAACATTTTGTTAATTCTCTTCTGTGGTAGAGATAGAAAGCTGCACACCTTTCCTAATTGGCAAATGATCAGACTAACACATGTGCTAATTTTGTTTCTTCCATGCTGAGTCAGATGTTGACTATTTTATCCTCCACAATTATATAACAAGTTGGAGGAGAGTTAAAACATTAAAGTAGAAGGCAGGAAAAATTTACTATTTGATTGTCCTAATTTTAGAAATTATATCCTTAAAAATTAACTGAAAACACAAATGCTAGGTGGAAATGATGAGAGAAATATATTTATTTCAGTGGAATTTTGCACATGTGAAAATTTTGTTAAATAGGACCTTAAAAATCCTAGGGTTTGTTTTTATTGTGGGAAACAAAAATCTTTTGCTAACACTGGCATTTTAAGGTGATAGAAATCAAAGACTGTTTCCTTGGGATTGACGTAGCTACCAAAAACATTCTTAGAGGCTTGGGATGTGGCTGTTGGCAACACATTTTATGGTGGGGTCTTGAATTCAATGATAAAATTTAAATAAAACCAAGCCAAAAATTATAGGTTTCTTTATTTTCACTAAACAGGCAATTTAAATACATGGTACAAAAATAAGTCGTAAGATTATTGTAAAATGAAATGGACAGAATATTCAATTTAATTTTCCATCTATGAGAATTTCACAATAAAATCATAGTTTACTTTGTATTATAGATGTGCTTGTTGGATCTATTCATCCTCTCATAAGGCAACTGAAAAATTAAAGTTATCGAATAGTTATTTGGGTGAAGATTTTAAAAAATGCTTCAAAAGATCTGTTTTTTTGCCTTATAGTATAAAGGGGGAAAGACTTCAGAAACTATTTTCTAAAGTAGATAAATGATACAAATGTTAGATGTGATGCCACACACTTCAGTTTTATATAGCAAGTTGTTCACACTGTCAGCTTATTCTTGATGAGTTAGCATAAAACATGATGTGAATTTAAGATGTAAGTATATTTACATTACTTAGCTTTGAAAATGCTAGTGGTGTTCTCCCATTGCAGTAAAGACGGGCTTACCACAAGATGTTTCAGCATGCTCCACTATTTGCTTTTATGAATATGCCAATATACCCCCATTTTCAAGTACACACATTTCAAGCTACTATGGGCTTTAAGTGAATAAAGGGAATTATCGCTCATCACATTATAAATCTAAGGGGCTGCTGTGAATTAGCTTACTAATAAGTTAAGACTTCTAAAAGTAAGCAGTGTTCTCTCTGGGATATGCCTGCAGAATAAGTCATTCCAGTCTGAGCAATAACTTCCTGTTCTTTGACCTTGGACTGAAACTTCCTTTAACATACAAACAAGATGCCATTACACCAACCCTTCTTTATCTTCCCATTAAAACTTCAAAACAATCCTATACTGACATTATCTCCTATTTGCAGATGAACTTAGTCATGGAGCTGCAGCAGGAACCCAGGTCTTCAAACTACCAATACAACTTAGTGCTGCCACTTCCCTGTGGACTTAAATTCTAATTTAAAGGGACTACTAGGGAATTTTACTACAGGTAAACTTGGGATTTCAT