Transcript asmbl_20754

Sequence
Transcript Sequence for observation asmbl_20754 of TGE0004029:
GTGGAGACCTTCAGGCGGAGCGCGGGTCTCTAGGAGCTATGGGGCACGCCCGGGATTTCGTCTGGGCGCTTCTGGGGCTGTGGCTGCTACTGTGCAGCTGGAGTTGCCTCGGGAGCGCCGAGCTGCGTGCTCCGCCGGATAAGATCGCGATTATTGGAGCTGGAATTGGTGGCACTTCGGCAGCCTATTATCTGCGGCAGAAATTTGGAAAAGATGTGAAGATTGACCTGTTTGAAAGAGGAGAAGTTGGGGGCCGTCTAGCCACCATGACTGTGCAGGGGCAAGAATATGAGACAGGAGGTTCAGTCATCCATCCTTTAAACCTACACATGAAGCGCTTTGTCAAAGACCTGGGTCTCTCTGTTGTCCAGGGTTCTGGTGGCCTAATTGGGGTGTATAACGGAGAGAGTCTGGTGTTTGAGGAGAGCAGCTGGTTTATAATTAACATAATTAAACTAATCTGGCAGTATGGATTTCAGTCCCTTCGAATGCACATGTGGGTAGAGGATATATTAGACAAGTTTATGAGGATCTACCGCTACCAGTCTCATGATTATGCCTTCAGTACTGTAGAAAATTTACTGCATTCTCTAGGAGGGGACGACTTCCTTGGAATGCTTAACCGAACACTTCGTGAAACCTTGCAGAAAGCAGGCTTCTCTGAGAAATTCCTCGATGAAATTGTTGCTCCTGTCATGAGGGTCAATTATGGCCAAAGCACAAACATCAATGGTTTTGTGGGGGCAGTGTCACTAGCTGGTGCTGATTCTGGCCTTTGGGCAGTAAAAGGTGGCAATAAACTTATTTGCTCAGGGCTCCTTCAGGCTTCCAAAGGCAACCTTATATCTGGCTCAGTAATGTACATAGAGGAGAAAACACGGACCAAGCAGACAGGAACCCCCGCAAAGATGTACGAAGTGGCCTACCAAACTGGATCTGAGACCCATTCAGACTTTTATGACATCATCGTGGTGGCCACTCCATTGAATCGAAAAATGTCCAATATAACTTTTCTCAACTTTGATCCTCCAATTGAGGAATTCCATCAATACTACCAATATATTGTGACAACTTTAATTAAGGGGAACTTGAATTCCACTATTTTTAGCTCCAGAGCCTTAGGTAAATTTGATCTCAGTACAATCTTAACCACTGATAATTCAGATTTGTTCATTAACAGCATTCGGATTGTGTCCTCTGTAAGAGAAAATAATCCTCAACCATCAGAAGATGGGGCATATGTTTGGAAGATCTTTTCCCAAGAAACTCTTACTAAAGAACAAATTTTAAAGCTCTTTTTGTCCTATGATTATGCTGTGAAGCAGCAGTGGCTTGCATATCCTCACTATAAGCCTCCAGAGAAATGCCCCTCTATCATACTTCACGATCGACTTTATTACCTCAGTGGCATAGAGTGTGCAGCAAGTGCCATGGAGATGAGTGCCATTGCAGCCCACAATGCCGCTCTCCTTGCCTATCACCGCTGGAATGGACATACAGATATGATTGACCAAGAGGATTTATATGAGAAACTTAAAACTGAACTATGAAATAATAACACTTTCACTTTTCCCCCCTCTTGGTTCCCAGTGGAATATCACTGGCAAAAAAGAACACAATCTGAGCAGAGATGTTTTCAAATCACATATTTTGCCATTATTGTTTAACATGAGTAATTCTAGTGTCATGAGAAAATATAAGGATCTCATAAGCGTGAAAGTGTAACTACTGCACTTATCCCATCTCCAAAATTTCTTAACTCTTCTTTTAATACCCATCAGCAGTGTTTCCCAAACTTGTTTGATCGTAAGAATCATTTGAGGTTTGATAAACATATAAAATTCTCTAGCTCTTCTGGAGATTGATTCAGTAGGTCTGGAGATGAGGCCCTGGATTTTGAATAAAATCTTAGAACATTTGAAGCTGAACACTTGAATTAGAACTTAAGACACGTTTTAGTTGGGGACTAGTTTATTTGTACTTCACAGCTGGATGTGATCTTGAGTCAGATAGTTAAAACTGCTGTAGGAGTTGGTATCTTATGCCTGGCTTTAGTAATTTATACTCTTTTTCAAAGTAAATGCCTCACCGAAGCCTTGACTTTCAGAATGTTTTTTTGATTTCTTCTGTCTCATTTTTTAAGGGTGAAATTTGTAAGTCTTAGTAGTATAACTTTAAGATGTCTTACAAAAGTCTCTAGTAAAATGAAAAGCAAATATAGGCTCATTGAAGAAATTGGCATTCAATTATCGAATCCTCACCCACGTATTTAGAAAATACTGATATACCCTATAGATTATTTAATGGACTGAGGATAGGACCTCCGCATTGTAGCTTGTTAAAAGTTCCTGATGTGCAGCCTGGGTCGAGAATCACTGACTTGGAGAGTCTAATATGTTTCCAAAGGGTTTTTCAGTGCCTTCAAAGTCCCAAGAAATCCAATTCATTATCAAAGCAGATGGATTTTGTGAAGAATTTCTCAGAACTCTAGTGGTAACCTTGATAGTAAGCAGCATTGACAGCCTAACAGCAGAGGTAACTTGGATTACTCCAGAGTTGACACAAGTAAGATACTCGTAATGACACCATGCTTGATCAAATCCAGCATATGTCCAAACTGTTAAATGCTTCTAAAGCTACTGGTACCATTTTGGGTGAGAAATTGGTTCCTGAAATCTTTTAATGCGTTAAGTTCTCAACCTTGGCTGCACATTGGAATCTTCTGTTGGACTTTAAAGCTTCCCAAATGATTCTAATATGCAGCCAAGCTTGAGAATCAGTTCTACATCTACTGTATTAAGATCATTAATGACTGTCCTTATAGTCACTGTTAGGACAGAACACATAAAAGCTTGTGAATTCAACAGTAACAGCAACAAAGTTAACATGTACTGTTAAAAAAATTTGTCAAAGGTTTTTTTTTCTAATTTTATTTTTAAAAAGAATGTTGAGGCAATTTTCTTTTCCTTTTGTGGTTTTAATGGACAGTATGCGGAGAATGTAATATACTGTGCTATGTATATGCTAGACTGGTAAATACTAATAGTTAACTTAGAACTTGTTTTGCAATGGGATATATGTCAAGCATATTTGTTTTAATGCAATCATGGTATTAAAGGATATATGTATTTTTTATTGGACAAAAAATACTATCAGAGCTTGTTACTCCAGAAGACCACTCATCCTTTTACAGAAGAGAATGGTAAAGGGCTGAATGAAAGCCAGCTCCACTCTAGTGGTTCTCCGACTTAGGTATGCATCAGACTTACCCGGTGGGCTTGTTAAAACATTTCTGGGCTTACCCCCAGAATGTGTTTTAATAGGGTTTGGGGTGGCATACAAAAATTTGCATTTCTGTTAAGTTCCTAGGTGATGTTCCTGGTCTAGGAACCACACTTAAAAGAGAACTAGTTCTGTAATTCAGCTCTAAGTGGTTGAAAAATTGAAAGCCTGTCAGCTTCAATGAAGATTTAAAAAGAGCTACTGGAGAAGAATGTTAGAATAAAAATGTTGGACTTCACACCAGCTCTCCTTATTGTGATTAGGTTGGTTTGAACCCTCTAGCTGTTCTTTTGCTGTAAATAGGAAATATTATTTTAGAGCTACATCAGGTGTGCTCACTGTATACCCCATTCTCTGCAGTTTTAAAGTGACTCAAGATTTGTAGTATTTTTACCAGATCACAAAAAGAACAGGTCTAGTCATTTACTTGGTAGGTTTCTTAAGGTTAGGCTTATGATACAACCATCTGTATGTAATATAGCTTTCATCAGTTGGTGTGCCCTCAAATGTATGAACTAGATGAATGTATTATGGCAGCATCATCATTACTCTCTATACTTTACAAAGAACAATACACTGGAATGTTTTTCTCTGGAATTCTATTTCTACTCTTGTATTAAAAATTTTTTCCCACTTATGTTCGAAATAAACAACTACATCATTAATTCCTGTTTTACTTTTGTTGTACTATACTTGGAATGTAGATGTACTTGAAAAAGCCAGAGTATATCAAAG